An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on the development of high-quality vegetable varieties for professional growers in food-producing horticulture, be that in glasshouses, tunnels or outdoors. Middle position in world top 10 globally-operating vegetable breeding companies Around1900 employees all over the world 1.000 varieties in approximately 30 different vegetable crops Sell seeds in more than 100 different countries all over the world RZ NGS projects overview . Gene prediction . SNP calling: RNA-seq, DNA . Gene expression analysis . Transcription binding site Prediction (miRNA) . Protein functional analysis (domain prediction, structural analysis) . Orthologue gene prediction .Server maintenance .G browser .SNP database .Species: Tomato Cucumber Melon / water melon Pepper Lettuce … SNP Identification for watermelon Single-nucleotide polymorphism (SNP, pronounced snip) is a DNA sequence variation occurring when a single nucleotide —A, T, C or G — in the genome (or other shared sequence) differs between members of a biological species or paired chromosomes in an individual. Genetic marker General information Resources: RZ 900 RZ 901 (parents lines with different Phenotypes) Illumina hiseq 2000 paired end reads Reference assembly version: Watermelon V70 Purposes *Used as genetic markers for genetic mapping. *Used as genetic markers associate with certain genes or phenotypes The interesting SNPs 1. Homozygous SNPs which are different between 2 parents lines 2. Evenly distributed on the Chromosome 3. Can be uniquely amplified by PCR, then proper for SNP validation assey SNP Identification workflow for watermelon BWA + picard + GATK SNP validation SNP calling by GATK BWA picard SNP calling result VCF format scaffold9 721024 . T C 752.98 . AC=2;AF=0.50;AN=4;BaseQRankSum=1.087;DP=34;Dels=0.00;FS=25.118;HRun=1;HaplotypeScore=1.4816;MQ=59.32;MQ0=0;MQRankSum=- 0.845;QD=41.83;ReadPosRankSum=-0.742;SB=-354.80 GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48,716 SNPs selection criteria 1. DP > 10 GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48,716 2. AD ratio <=0.2 GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48,716 AD ratio sample1: 0/(0+18) < 0.2 alternative homozygous AD ratio sample1: 16/(0+16) > 0.8 reference homozygous 1122778 homozygous SNPs found differing between RZ900 and RZ901 SNPs chromosome distribution SNP selection Step1. generating maker sequence without flanking SNP Length: 101bp, SNP in middle with 50bp flanking marker Format: >scaffold1_10477 TAGTACATTTCTATTATTCAACTGTGAGTTATTTTCGAAGTTTTATTAAT[T/G]TTCGTTTTTTATTTATAACTTTCAATTAATTAGAAAAATAGTAAAAACT Excluding the markers with flanking SNPs >scaffold1_13888 AAATATTTTTAAATATAAGAAAGTGTCATTGTTTATCAATAATAGACACT[G/A]ATGGATAAAnATTTTGTTATGTTTGTAACTATTTTGGTTTATTGCTGT