Journal of Mycology Research. Vol 1, No 1: Page 43-53, September 2014 Role of denture-wearing on colonization and antifungal resistance of oral Candida albicans isolates in healthy people 1* 1 2 3 1 2 Ghasem Vahedi , Golnaz Sharafi , Ali Vahedi , Sahra Vahedi , Tabassom Mohajer , TeimurAbbasi 1 Mycology Research Center , Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran 2 Faculty of Dentistry, Tabriz University of Medical Science, Tabriz, Iran 3Faculty of Nursing and Midwifery, Tabriz University of Medical Science, Tabriz, Iran * Corresponding Author: Email: [email protected], Tel: +98(935) 3339777 (Received: 10 May 2014, Accepted: 22 July 2014) Abstract: The primary focus of the present study was to evaluate the occurrence of Candida albicansisolates in the oral cavity and its probable correlation with dental implant applications and prosthesis. We collected oral swabs from patients who had attended private dentistry clinics, followed by stringent and controlled antifungal susceptibility testing and calculation of colony forming units (CFUs). Amphotericin B, Fluconazole and Itraconazole were three antifungals tested by CLSI M27-A2 broth microdilution protocol. The MIC ranges for three tested antifungals in Candida albicansisolates were obtained as 0.0625-1, 0.125-16 and 0.0313-0.5 μg/ml, respectively. Additionally, in non- Candida albicansisolates, MIC ranges for three antifungals were achieved as 0.25-1, 0.125-16 and 0.0313-0.125 μg/ml, respectively. MIC50 values of both tested azoles in the Candida albicansgroup were higher than related values in the non-Candida albicans group. Moreover, CFU counts for denture-acquired people were higher than for participants not wearing denture applications, indicating the proposal that the surface of dentures or any other synthetic implants in the oral cavity may result in providing an appropriate environment for the colonization of yeasts. Keywords:antifungal, resistance, CFU, denture, Albicans. microorganisms in the oral cavity of the host (Fidel Introduction et al. 1999). Candidaspecies are the predominant cause of fungal infection in humans. In most cases, the The oral cavity comprises a large and highly source of the infection is endogenous commensal diverse population of opportunistic and pathogenic flora from the mucosal surfaces. In addition, microorganisms. Candidaand other yeast species Candida species are a major cause of oral are the main fungal flora in the oral cavity (Akpan candidiasis. The most common form of oral and Morgan 2002). However, there are complex candidiasis is denture-related stomatitis (DRS) interrelationships among oral microbiota, which with Candida albicans (C. albicans) as the main determines their population size and opportunistic cause (Figueiral et al. 2007). Moreover, denture- behaviour. Generally, these microorganisms exhibit plaques containing Candidaspp. are one of main commensal and symbiotic attributes; however, in subsequent challenges for patients with DRS particular situations, for example, in the case of (Nikawa et al. 1998). However, generally, the compromised patients, they can also exhibit a more defence mechanisms of a healthy host consistently disadvantageous side. Moreover, some unwelcome limit and control the microbiota populations changes in the natural oral environment, such as present on oral surfaces. On the other hand, the denture settings, can result in the undesirable microbes have to react against host defence to alteration of oral microscopic inhabitants. This survive (Boix and Nogués 2007). In this mean, the may facilitate the emergence of resistant pathogenic 43 JMR (Sep.2014), 1(1) Role of denture-wearing in oral Candida Ghasem Vahedi el al. adherence ability of microbes on mucosal surfaces Materials and Methods is a key feature. Furthermore, the unsafe use and Specimen collection and growth conditions: inappropriate hygienic care of external and internal Twenty-five individuals referred to private dental dental prosthetic devices such as partial or complete clinics in Miandoab, West Azerbaijan Province, dentures and dental implants may cause these set- Iran, participated voluntarily in this study. The tings to act as a microbial reservoir and adherence demographic conditions of both denture-wearing within the oral environment (Allen et al. 1999). and non-wearing groups were roughly similar. In recent years, more attention has been focused Twelve patients wore denture(s) and 13 did not own on understanding the roots of antifungal resistance any dentures. The detailed history of wearing as a result of increasing reports of resistance to dentures and other external medicinal antifungal drugs. Polyenes and azoles are two interventions, as well as any lesions or scars present most-often prescribed antifungal derivatives in the oral cavity was documented. Aquestionnaire which drug resistance to these groups of anti- was designed for recording valuable data including fungals is usually reported by researchers (Sanglard information regarding age, sex, oral lesions, any and Odds 2002). Among Candida species, history of health problems, drug usage, blood type acquired resistance to Amphotericin B (AmB) as a and smoking. Samples were collected from the oral main known polyene is infrequent. Some Candida cavity by sterile swab from the upper and lower species, such as Candida krusei, has emerged as gingival, or in individuals with dentures, from the intrinsically resistant to azoles (Kanafani and surface of upper and lower dentures, and in the case Perfect 2008). This resistance to azoles has been of oral lesions or ulcers, from the lesion or ulcer stated by many research teams and more frequently surfaces. Swabs were cultured on Sabouraud than a resistance to AmB, possibly due to the more dextrose agar (Merck, Germany) and common administration and fungi-static nature of supplemented with 0.5% Chloramphenicol these antifungal agents (White et al. 1998). (Sigma-Aldrich Inc., USA) at 35°C for seven days. Furthermore, one recent scientifically-discussed Colony counting and species identification: important predisposing factor for antifungal To deny observer error and increase accuracy, we resistance emergence in Candida spp. is the took digital photographs of the SDAculture's front formation of biofilms. Biofilms are primarily a mix surfaces and saved them on computer; then, yeast of yeast and bacteria species on appropriate colonies per swab (CFUs/swab) were counted synthetic or natural surfaces such as catheters and from the saved digital images using OpenCFU dentures (Chandra et al. 2001). Due to the complex software version 3.8.4 (Geissmann 2013). This and usually impenetrable structure of biofilms and was followed by a microscope examination using the high expression of resistance-related genes in lactophenol cotton blue staining. Candida yeasts present in biofilms, they demonstrate higher albicans isolates were distinguished from other levels of resistance to antifungals (García-Sánchez yeasts by a series of specific tests including germ et al. 2004). tube formation, incubation at 45°C, culture on TM The aim of the present study was to clarify the CHROMagar Candida(CHROMagar, France), possible impact of denture-wearing on colonization culture on cornmeal agar containing tween 80 and antifungal resistance of oral Candida albicans media (Sigma-Aldrich Inc. USA) and Sabouraud and non-Candida albicansisolates. We expect the dextrose agar containing 6.5% NaCl (Merck, possibility of a higher colonization count and Germany) (salt tolerance test); additionally, resistance of yeast isolates from healthy denture- RapID™ YEAST PLUS System (Remel, USA) wearing volunteers compared to healthy but non- tests and a PCR assay were conducted. All the tests denture-wearing individuals. were conducted according to the instructions documented by their manufactures or were based on published protocols. The salt tolerance test and 44 JMR (Sep.2014), 1(1) Ghasem Vahedi el al. Role of denture-wearing in oral Candida incubation at 45°C was conducted to distinguish Aldrich Inc., Germany) buffers. All stages of between suspected Candida albicansand Candida preparation and susceptibility testing were dubliniensis isolates Swabs were cultured on conducted according to the M27-A2 standard Sabouraud dextrose agar (Merck, Germany) and protocol of the Clinical and Laboratory Standards supplemented with 0.5% Chloramphenicol Institute (CLSI). A 100-fold dilution of each (Sigma-Aldrich Inc., USA) and incubated at 35°C Itraconazole and Fluconazole antifungals and a 10 for seven days. times dilution of Amphotericin B were prepared in PCR identification: All yeast isolates were dimethyl sulphoxide (DMSO) and normal saline, incorporated in a PCR assay using two pairs of respectively. Itraconazole and Amphotericin B in a Candida albicans- and Candida dubliniensis- ratio of 1:50 and Fluconazole in a ratio of 1:5 were specific primers from a series of published added to the RPMI solution. Thus, 10 dilutions of Multiplex PCR primer pairs (Lim and Lee 2002) to Itraconazole and Amphotericin B at concentrations establish a standard PCR assay. Candida albicans- of 1600 μg/ml to 3.13μg/ml and 10 dilutions of specific primer sequences read as follows: Fluconazole at concentrations of 640 μg/ml to 1.25 forward: μg/ml were prepared. To prepare the yeast AAGCTCTGATACCTACACTAGCGA; reverse: suspension, first, from all yeast isolates, fresh 24- GTTAGGTCTAAAGTCGAAGTCATC; these hours cultures were prepared at 35ºC. Then, a sequences are highly specific for the Candida standard solution of McFarland 0.5 was prepared albicans integrin-like protein coding gene and absorbance was adjusted to 0.1 at a 530 nm (αINT1). Candida dubliniensis-specific primer wavelength using a spectrophotometer. The sequences read as follows: forward: McFarland 0.5 suspension was employed to GCATTTGGTACCGTAAGGATACCA; reverse: visually assess the concentration of yeast CACTAGATGATTCCGGTGTTTTGG; these suspension tubes. The number of yeasts in the sequences are highly specific for the Candida suspension tubes prepared by the method dubliniensis agglutinin-like sequence protein described above was between 1x106 -5x10 6 coding gene (ALS). DNA extraction was done yeasts/ml. The next step was preparing dilutions of based on glass bead disruption and the phenol- yeast suspensions in a ratio of 1:50 using distilled chloroform extraction method (Amberg et al. water or normal saline, which for the concentration 2006). The PCR program was also adjusted of the tubes would be between 2x104 - 1 x105 according to instructions recommended by the yeasts/ml. Additionally, further dilution was authors of the previously mentioned multiplex required, at which the yeast suspensions were PCR article (Lim and Lee 2002), with slight diluted at a ratio of 1:20 using the RPMI stock modifications. solution, at which point the concentration of tubes 3 3 In vitro antifungal susceptibility testing: reach 1x10 -5x10 yeasts/ml. The resulting Antifungal agents including Itraconazole, suspensions of yeast were employed as inoculum Fluconazole and Amphotericin B were used in this suspensions in the 96-well flat-bottomed sterile study. All drugs were purchased as standard plastic microtiter plates. In the final step, the broth powders from Sigma-Aldrich Inc., Germany. A microdilution method was performed using the 96- stock solution was prepared at concentrations 100 well flat-bottomed sterile plastic microtiter plates. times higher than the final concentration and stored The inoculation was conducted in a clean at -70°C until use, according to manufacturer environment using a standard microbiological instructions. For the susceptibility testing of hood; 100 µl of all prepared dilutions of antifungal antifungal agents, RPMI 1640 medium (with L- agents were dispensed in the first 10 wells of a 96- glutamine and without sodium bicarbonate) well plate, followed by 100 µl of yeast inoculation (Gibco) was dissolved in suspension. In each row, one well served as a morpholinepropanesulfonic acid (MOPS) (Sigma- control without the drug and another as a control 45 JMR (Sep.2014), 1(1) Role of denture-wearing in oral Candida Ghasem Vahedi el al. without yeast. Standard ATCC strains as well, according to M27-A2 standard guidelines, as quality control, like other yeast isolates, in related wells, were inoculated and all testing was conducted in duplicates. Following on, all 96 inoculated well-plates were incubated for 48 hours at 35ºC. The minimum inhibitory concentrations (MICs) of test wells were visually characterized and compared to the growth rate of control wells. Statistical analysis: We performed statistical tests using MedCalc software version 13 (Schoonjans et al. 1995); because distribution of our dependent continuous data regarding CFU Fig. 1. Number of yeast species isolates from denture wearing counts were not normal at a P value of less than (Denture) and not wearing (noDenture) groups indicated by orange color for the Candida albicansisolates and Blue color for 0.05, according to the Kolmogorov-Smirnov test non-albicans yeast isolates within the bars. of normality, we chose the Kruskal-Wallis test as a non-parametric equivalent to ANOVAto test the significance of the difference in CFUs counted for denture-wearing and non-wearing groups. To determine any difference in antifungal susceptibility, we interpreted our results according to various groups of participants and thereby accomplished our aim through a series of chi- square tests conducted on our independent categorical variables (groups and species). Moreover, we performed a proportion test for revealing possible differences between the proportion of subgroups in the Fluconazole's MIC interpretations and the Intraconazole's MIC Fig. 2. Representation of differences of the CFU means between interpretations. According to the predefined species groups including C. albicansand non-albicans indicated by Albicans and noAlbicans under the bars, respectively. factors of the performed tests, Pvalues of less than 0.05 were assumed as significant. Additionally, Table 1. Distribution of yeast identified species isolated from because of the low number of each non-Candida denture wearing and not wearing healthy people. albicans species and for achieving a convenient Yeast species Number (%) sample size and more reliable statistical results Candida albicans 14 (40%) with a minimum bias, we assumed all non-Candida Candida glabrata 6 (17.1%) albicansisolates into one group. Candida dubliniensis 6 (17.1%) Candida tropicalis 4 (11.4%) Results Candidaparapsilosis 2 (5.7%) Unknown yeast 3 (8.7%) Total 35 (100%) Twelve denture-wearing and 13 non-denture- wearing healthy individuals participated in the implying a two-fold increase in yeast isolation study, in which a total of 35 yeasts were isolated. In counts in the denture-wearing group. From a total total, 12 (34.3%) isolates were from non- denture- of 25 participants, 16 (64%) had been colonized by wearing individuals and 23 (65.7%) isolates were yeast species. Moreover, 11 (91.7%) denture- from denture-wearing volunteers, roughly positive patients out of 12 were colonized by 46 JMR (Sep.2014), 1(1) Ghasem Vahedi el al. Role of denture-wearing in oral Candida Table 2. MIC50, MIC90, Range and number of resistant and non-resistant isolates in species groups including C. albicansand non-albicans groups. aResistant isolates of yeast species. bNon-resistant isolates of yeast species. MIC μg/ml Ra non-Rb Yeast species Antifungal agents 50% 90% Range N (%) N (%) Amphotericin B 0.5 1 0.0625-1 0(0%) 14(100%) C. albicans Fluconazole 16 16 0.125-16 0(0%) 14(100%) Itraconazole 0.5 0.5 0.0313-0.5 0(0%) 14(100%) Amphotericin B 0.5 1 0.25-1 0(0%) 18(100%) non-albicans Fluconazole 4 16 0.125-16 0(0%) 18(100%) Itraconazole 0.25 0.5 0.0313-0.125 0(0%) 18(100%) Table 3. Differences in number of resistant and non-resistant denture-negative group. Furthermore, scrutinizing yeast isolates tested against three antifungal agents in comparison of two denture wearing and not wearing groups. the possible differences in CFU counts by aResistant isolates of yeast species. bNon-resistant isolates of assuming each yeast species to have been present yeast species. in the statistical test resulted in even more highly Denture wearing No denture wearing significant values in CFUs/swab count means Antifungal agents Ra non-Rb Ra non-Rb comparison between C. albicansand non-albicans N (%) N (%) N (%) N (%) yeast groups. CFU counts level in the C. albicans Amphotericin B 0 (0%) 20 (100%) 0 (0%) 12 (100%) group was significantly higher than in the non- Fluconazole 0 (0%) 20 (100%) 0 (0%) 12 (100%) albicans yeasts group (P= 0.000099, Kruskal- Itraconazole 0 (0%) 20 (100%) 0 (0%) 12 (100%) Wallis test) (Please see Fig. 2). Antifungal susceptibility testing results showed yeasts, whereas only five (38.5%) denture- a notable drop in the MIC50 and MIC90 rates of negative participants out of a total of 13 had been azoles in the non-albicans group compared to the C. colonized by yeasts; as such, the difference albicans group. MIC50 values of fluconazole between the two groups were significant (P = susceptibility testing in the non-albicans group 0.0187, chi-square test). The C. albicans isolates were lower than related values in the C. albicans number in the denture-wearing group was 12 group. Additionally, MIC50 of Itraconazole in the compared to two in the non-denture wearing group, non-albicans group was 0.25 in comparison to 0.5 while non-albicans yeast isolates were counted as in the C. albicansgroup (Please see Table 2). 8 in the denture-wearing group, compared to 10 for We did not observe any significant difference the non-denture-wearing group (Please see Fig. 1). between the resistant and non-resistant (by The difference between groups were significant (P assuming susceptible and susceptible dose- = 0.0430, chi-square test). From a total of 35 yeast dependent as non-resistant group) frequencies of isolates we were able to identify, C. albicans, C. each antifungal drug across the species groups glabrata, C. dubliniensis, Candida tropicalisand (please see Table 2). Candidaparapsilosis, with frequencies of 14, 6, 6, Investigating the antifungal susceptibility 4 and 2, respectively. Three remaining unknown testing values across the denture situation again isolates were defined as missing data, because of demonstrated no significant differences when their erroneous identification and antifungal comparing antifungal resistance across the susceptibility testing results (Please see Table 1). denture-wearing and non-denture-wearing groups Moreover, differences between the means of (Please see Table 3). However, for the Fluconazole CFU counts in the denture-present group group, we had 16 (50%) SDD isolates, whereas in compared to the denture-absent group was highly the Itraconazole group, there were only 8 (25%) significant (P= 0.001730, Kruskal-Wallis test); in SDD isolates. The difference was not significant other words, CFUs/swab means in the denture- but considerable (P= 0.0707, test of proportion). positive group were significantly higher than in the 47 JMR (Sep.2014), 1(1) Role of denture-wearing in oral Candida Ghasem Vahedi el al. Discussion group was 0.25-1 μg/ml, whereas in the non- denture-wearing group it was 0.625-1 μg/ml (data Some of the yeast species are natural inhabitants of not shown). Furthermore, both MIC50 and MIC90 the oral cavity. Based on published reports, they are of AmB in the denture-wearing group were 1 present in the oral cavity of about 60-80% of μg/ml, while related values for the non-denture- healthy people (Cannon et al. 1995; Sanchez- wearing group were 0.25 μg/ml and 0.5 μg/ml, Vargas et al. 2005). Candida albicansis one of the respectively, indicating higher frequencies of major yeast flora on human mucosal surfaces and higher values of MICs for AmB in the denture- can colonize 40-50% of healthy people; it is the positive group. However, the obtained MICs from fourth most prevailing cause of nosocomial blood AmB testing did not appear to be very high (the infections. Despite its pathogenic attributes and highest tested MIC concentration was 16 µg/ml). severe virulence factors, C. albicans in healthy These results indicated that denture-wearing may people can commensally live beside other natural affect the AmB-resistance of oral yeasts, human microbiomes and can help to regulate particularly C. albicansspecies, but this influence immune responses by consistent stimulation of the was somewhat average. Furthermore, it is now immune system (Pérez and Johnson 2013). clear that the sterol-binding feature is not the only Dentures are generally fabricated with metal or mode of action of AmB (Gray et al. 2012). thermosetting acrylic resins as a base. The base is Oxidative-dependent stimulation of the immune routinely equipped with plastic or porcelain teeth. system's polymorphonuclear (PMN) cells, a In this regard, there is evidence indicating the hypoxic environment, reactive oxygen species and impact of medical devices such as central venous some extracellular factors like secreted catalase, catheters or dentures on the microbial profile of the extracellular scavengers and pro-oxidants are also host organ. Yeast species can easily colonize the involved in the lethal action of AmB. Catalase, surface of catheters or the acrylic resin surfaces of which is produced by some bacteria and fungi (e.g., dentures (Verran and Maryan 1997). These C. albicans) can break down oxygen free radicals microbial colonies and filamentous networks on an and has a vital role in the survival of many appropriate and generally artificial field are known pathogens in stressed conditions. It has been as biofilms. Biofilms on dentures or catheters are observed that catalase can inhibit the lethal action mainly a blend of both bacterial and fungal species. of AmB (Brajtburg et al. 1990). The oral cavity, Additionally, because of their filamentous and because of its connection to the outside impenetrable structure, in addition to their altered environment and the transition of nutritional gene expression profile, they are typically resistant materials, is generally disposed to being affected to most of the standard antimicrobial therapies by many external factors. By scrutinizing patient (Allen et al. 2010). medical records, we found a history of smoking, Alongside environmental stimuli and location denture-related lesions (also termed denture- condition, each fungal species has different related stomatitis and Candida-associated denture characteristics in terms of colonization and induced stomatitis) and poor hygienic care of antimicrobial resistance abilities. For instance, C. dentures for most of the participants in which we dubliniensisis known to be more sensitive than C. isolated yeasts with higher AmB MICs, compared albicans to antifungal therapies (Sanglard and to MICs in non-denture-wearing individuals Odds 2002), while C. glabrataand C. krusei have (Pereira-Cenci et al. 2008). In our study, seven shown evidence of higher antifungal MICs or (35%) isolates with AmB MICs of 1 μg/ml from the intrinsic antifungal resistance (Vanden Bossche et denture-wearing group were C. albicans, while al. 1994). In our study, none of the 32 yeasts tested only two (16.7%) isolates with MICs of 1 μg/ml were Amphotericin B (AmB)-resistant. However, were C. albicans in the non-denture-wearing the MIC range of AmB in the denture-wearing group. Smoking can affect pH in the oral cavity and 48 JMR (Sep.2014), 1(1) Ghasem Vahedi el al. Role of denture-wearing in oral Candida as a result, the local denture environment can turn is known as the trailing effect, a known attribute of acidic; In addition, hypoxic environment can be azoles (Espinel-Ingroff et al. 2007). All of our created as a result of denture-wearing participants were medically-approved to be (Visvanathan and Nix 2010). An acidic healthy and as such, none of them had been extracellular environment favours C. albicans' receiving antifungal therapies at the time of higher enzymatic activity and can also cause specimen collection. Additionally, there was no changes in the oral microbiota population, history of antifungal administrations among resulting the dominance of C. albicans species. participants. Despite the AmB, for which acquired Furthermore, it has been observed that when AmB resistance is rare and which is known for its is present in a hypoxic environment, up to an 80% fungicidal properties, in the case of azoles - which reduction in lysis rates of C. albicans protoplasts are known for their fungi-static attributes - can occur compared to when incubations occur in acquired resistance occurs frequently, mostly the air (Sokol-Anderson et al. 1986). High during azole-antifungal therapy (Marichal and occurrence of yeasts, showing high MIC values of Bossche 1995). In this respect, where AmB was AmB (which in the current study were mostly concerned, MICs were classified as similarly isolated from denture-wearing individuals) may be susceptible or resistant. On the other hand, MIC the result of some unwelcome changes in hypoxic values for azoles were defined as susceptible, situations, reactive oxygen species production susceptible dose-dependent and resistant. Thus, amount, catalases produced by oral bacteria or considering the generally relative and acquired yeasts and the yeast population in the oral nature of resistance to azoles, the absence of any environment as a result of using dentures. We did azole-resistant isolate in our denture-wearing and not evaluate each mentioned factors non-denture-wearing healthy participants may independently, so we would not be eligible to have been due to their naïve nature regarding propose the exact factors and an acquired exposure experience to azoles, as none of our resistance occurrence is even rarer (Conly et al. isolates were known antifungal intrinsic-resistant 1992). The results of the current study might species. therefore direct us to the claim that isolated yeasts The final primary evaluated factor in our study with high MIC values to AmB in the denture- was colony count, which was compared between wearing group emerged due to denture-induced the two denture groups, as well as for two yeast environmental changes. However, further studies groups; both comparisons resulted in highly are required to clarify the main factor(s) and significant differences. These results were mechanism(s) involved. comparable to similar studies that have indicated In the current study, we also evaluated the higher colonization when complete or partial antifungal resistance levels of our yeast isolates to dentures are present in the oral cavity (Darwazeh et two azoles. We could not establish any proof in al. 2001; BarBeau et al. 2003). The acrylic resin terms of the differences in antifungal resistance surface of dentures may facilitate this phenomenon levels of yeast isolates when comparing the (Henriques et al. 2004). Moreover, most colonized denture-wearing and non-denture-wearing patients in our study were those who had been patients. In fact, in the case of AmB, MICs were challenged by Candida-associated denture- determined as the lowest drug concentration for induced stomatitis (CADS), which is the most preventing any discernible growth. For azoles, prevalent form of oral candidiasis. In 90% of cases, MIC was defined as a drug concentration for which Candida species are the predominant cause of a 50% reduction in turbidity was observed in CADS and among Candidaspecies, C. albicansis comparison with a drug-free control (Alexander et primarily responsible for CADS (Salerno et al. al. 2007). This phenomenon, which was observed 2011). Thus, elevated rates of CFUs in the denture- in a series of tandem wells in a 96-well-plate row, wearing group, as well as its higher incidence in the 49 JMR (Sep.2014), 1(1) Role of denture-wearing in oral Candida Ghasem Vahedi el al. C. albicansgroup could be justified. where the authors tested several antifungals, Results from other studies mainly support our including three azoles (but not AmB), in healthy observations; however, some contradictory denture-wearing people. No evidence of evidence also exists. Colonization of the oral cavity significant differences in antifungal susceptibility by Candida yeasts in elderly people were the between healthy denture-wearing group and subject of a study that resulted in 67% colonization healthy non-denture-wearing group were found of total cases by Candida spp., for which C. (Lyon et al. 2008). This finding is in agreement with albicansis the most frequently occurring species. our azole antifungal susceptibility testing results. However, this study could not show any relation An interesting retrospective study was also between denture-wearing and the occurrence of conducted to investigate the antifungal oral candidiasis, while there was a highly susceptibility and yeast colony numbers in people significant relationship between denture-wearing with full or partial dentures over a period of five and colonization by Candidaspp. (Grimoud et al. years. The results demonstrated that mean colony 2003). In a similar study, the incidence rate of number in full denture wearers was about two-fold Candida spp. in no denture wearers was higher the related number present in a partial denture compared to-denture-wearing participants. Again, group. C. albicanswas the most frequent isolated C. albicanswas the dominant isolate but there were yeast, but its frequency dropped during the five no significant differences between adults with and studied years, whereas other yeast species such as without dentures in the isolation frequency of C. C. glabrata showed an increasing frequency albicans(Zaremba et al. 2005). during the study's five-year period (Loster et al. Authors of another related study have found a 2012). We could not find any identical or link between denture-induced stomatitis, yeast comparable studies to our own in the literature, presence and denture hygienic care (Kulak-Ozkan which was conducted in Iran, except for two reports et al. 2002). Other notable research was conducted that evaluated only the yeast colonization levels in on two groups of denture-wearers, including denture-wearing and non-denture-wearing people. patients suffering from oral candidiasis and a In more recent research, the participants were control group without oral candidiasis to elderly people with heart conditions attending a investigate changes in antifungal resistance. hospital in Tehran, the capital city of Iran. Results However, the results did not show any differences, showed a higher percentage of oral colonization by possibly due to the similar denture status of the two yeasts in a denture-positive group compared to a studied groups (Koga-Ito et al. 2006). Additionally, denture- negative group and this difference was an evaluation of the isolation frequencies of highly significant. Mean CFU counts of C. Candidaspp. in complete denture wearers showed albicans in denture-acquired people was higher that 60% of people involved in the study had been than that for people with natural teeth and the colonized by Candidaspp. (Darwazeh et al. 2001). difference was highly significant (Taheri Sarvtin et Another group of researchers found that there was al. 2014). In another report performed in Iran, the no significant relation between oral Candida authors again evaluated the colonization of carriage and denture-wearing status (Martins et al. dentures by yeasts and identified them according to 2010). However, another research team stated that species level. C. albicans was the most often they had been able to isolate C. albicansspecies in isolated yeast, while the authors also stated that 66.7% of denture-positive people, compared to they had been able to isolate C. dubliniensisspecies only 28.9% C. albicans isolation in non-denture- at a considerable frequency (Zomorodian et al. wearing people, showing a highly significant 2011). A high prevalence of C. dubliniensis was difference (Daniluk et al. 2005). In a study that is to also observed in our study, which might direct us to some degree comparable to the present research, the proposal of a possible connection between antifungal susceptibility also was the subject, denture-wearing and colonization by C. 50 JMR (Sep.2014), 1(1) Ghasem Vahedi el al. Role of denture-wearing in oral Candida dubliniensisin healthy people. 3. Allen, E.P., Bayne, S.C., Becker, I.M., Donovan, Considering the above mentioned literature T.E., Hume, W.R., Kois, J.C., 1999. Annual sources, our study is possibly the first to primarily review of selected dental literature: Report of the focus on a comparison of three antifungal Committee on Scientific Investigation of the susceptibility testing values, as well as colony American Academy of Restorative Dentistry. The counts between healthy denture wearers and non- Journal of Prosthetic Dentistry, 82: 27-66. denture wearers in Iran. Other studies focusing on 4. Allen, H.K., Donato, J., Wang, H.H., Cloud- oral mycoflora in Iran have mainly employed Hansen, K.A. Davies, J., Handelsman, J., 2010. immunocompromised patients, particularly HIV Call of the wild: antibiotic resistance genes in positive individuals. However, there are some natural environments. Nature Reviews complications to such studies, including difficult Microbiology, 8: 251-259. sampling procedures, no standardized or general 5. Amberg, D.C., Burke, D.J., Strathern, J.N., 2006. antifungal susceptibility testing protocols for all Yeast DNAisolation: midiprep. Cold Spring Harb yeast species, observer error when visually Protocols, 1:2006(1). interpreting MIC results, the presence of both 6. BarBeau, J., Séguin, J., Goulet, J.P., de Koninck, intrinsic antifungal-resistant and non-resistant L., Avon, S.L., Lalonde, B., Rompré, P., isolates belonging to one species and the Deslauriers, N., 2003. Reassessing the presence of possibility of errors in microdilution broth Candida albicans in denture-related stomatitis. protocols, due to extensive hand manipulation and Oral Surgery, Oral Medicine, Oral Pathology, Oral human involvement during the testing procedures. Radiology, and Endodontology, 95: 51-59. 7. Boix, E., Nogués, M.V., 2007. Mammalian Conclusion antimicrobial proteins and peptides: overview on the RNase A superfamily members involved in Wearing dentures may lead to an increase in the innate host defence. Molecular Biosystems, 3: colonization of oral yeasts. Moreover, wearing 317-335. dentures may cause slight changes in antifungal 8. Brajtburg, J., Powderly, W.G., Kobayashi, G.S., susceptibility values, although these changes are Medoff, G., 1990. Amphotericin B: current not significant. The changes may occur in specific understanding of mechanisms of action. situations, for example, if dentures are not Antimicrobial agents and chemotherapy, 34: 183. regularly cleaned or other predisposing factors 9. Cannon, R., Holmes, A., Mason, A., Monk, B., consequently occurred with denture-wearing, such 1995. Oral Candida: clearance, colonization, or as smoking. Further precise studies are required to candidiasis? Journal of Dental Research, 74: gain a clear understanding of the exact effect of 1152-1161. each factor on oral fungal inhabitants. 10.Chandra, J., Mukherjee, P.K., Leidich, S.D., Faddoul, F.F., Hoyer, L.L., Douglas, L.J., Ghannoum, M.A.,2001. Antifungal resistance of References candidal biofilms formed on denture acrylic in 1. Akpan, A., Morgan, R., 2002. Oral candidiasis. vitro. J Dent Res, 80(3):903-8. Postgraduate Medical Journal, 78: 455-459. 11.Conly, J., Rennie, R., Johnson, J., Farah, S., 2. Alexander, B.D., Byrne, T.C., Smith, K.L., Hellman, L.,1992. Disseminated candidiasis due Hanson, K.E., Anstrom, K.J., Perfect, J.R., Reller, to amphotericin B-resistant Candida albicans. L.B.,2007. Comparative evaluation of Etest and Journal of Infectious Diseases, 165: 761-764. Sensititre YeastOne panels against the Clinical 12.Daniluk, T., Tokajuk, G., Stokowska, W., and Laboratory Standards Institute M27-A2 Fiedoruk, K., Sciepuk, M., Zaremba, M., reference broth microdilution method for testing Rozkiewicz, D., Cylwik-Rokicka, D., Kedra, B., Candida susceptibility to seven antifungal agents. Anielska, I., 2005. Occurrence rate of oral Journal of Clinical Microbiology, 45: 698-706. 51 JMR (Sep.2014), 1(1) Role of denture-wearing in oral Candida Ghasem Vahedi el al. Candida albicans in denture wearer patients. Colloids and surfaces B: Biointerfaces, 33: 235- Advances in Medical Sciences, 51: 77-80. 241. 13.Darwazeh, A.M-G., Al-Refai, S., Al-Mojaiwel, S., 22.Kanafani, Z.A, Perfect, J.R., 2008. Antimicrobial 2001. Isolation of Candidaspecies from the oral resistance: resistance to antifungal agents: cavity and fingertips of complete denture wearers. mechanisms and clinical impact. Clin Infect Dis, The Journal of Prosthetic Dentistry, 86: 420-423. 1;46(1):120-8. 14.Espinel-Ingroff, A., Canton, E., Gibbs, D., Wang, 23.Koga-Ito, C.Y., Lyon, J.P., Vidotto, V., de A., 2007. Correlation of Neo-Sensitabs tablet Resende, M.A., 2006. Virulence factors and diffusion assay results on three different agar antifungal susceptibility of Candida albicans media with CLSI broth microdilution M27-A2 isolates from oral candidosis patients and control and disk diffusion M44-A results for testing individuals. Mycopathologia, 161: 219-223. susceptibilities of Candidaspp. and Cryptococcus 24.Kulak-Ozkan, Y., Kazazoglu, E., Arikan, A., 2002. neoformans to amphotericin B, caspofungin, Oral hygiene habits, denture cleanliness, presence fluconazole, itraconazole, and voriconazole. of yeasts and stomatitis in elderly people. Journal Journal of Clinical Microbiology, 45: 858-864. of Oral Rehabilitation, 29: 300-304. 15.Fidel, P.L., Vazquez, J.A., Sobel, J.D., 1999. 25.Lim, Y-H., Lee, D-H., 2002. Multiplex Candida glabrata: review of epidemiology, polymerase chain reaction assay for simultaneous pathogenesis, and clinical disease with detection of Candida albicans and Candida comparison to C. albicans. Clinical Microbiology dubliniensis. Journal of Microbiology-Seoul-, 40: Reviews, 12: 80-96. 146-150. 16.Figueiral, M.H., Azul, A., Pinto, E., Fonseca, P.A., 26.Loster, B.W., Loster, J., Wieczorek, A., Branco, F.M., Scully, C., 2007. Denture-related Ryniewicz, W., 2012. Mycological analysis of the stomatitis: identification of aetiological and oral cavity of patients using acrylic removable predisposing factors - a large cohort. J Oral dentures. Gastroenterology Research and Practice Rehabil, 34(6):448-55. 2012. 17.García-Sánchez, S., Aubert, S., Iraqui, I., Janbon, 27.Lyon, J., Moreira, L., Cardoso, M., Saade, J., G., Ghigo, J.M., d'Enfert, C., 2004 Candida Resende, M., 2008. Antifungal suscepitibility albicans biofilms: a developmental state profile of Candidaspp. oral isolates obtained from associated with specific and stable gene denture wearers. Brazilian Journal of expression patterns. Eukaryot Cell, 3(2):536-45. Microbiology, 39: 668-672. 18.Geissmann, Q., 2013. OpenCFU, a new free and 28.Marichal, P., Bossche, H.V., 1995. Mechanisms of open-source software to count cell colonies and resistance to azole antifungals. ACTA other circular objects. PloS one, 8: e54072. BIOCHIMICAPOLONICA-ENGLISH EDITION- 19.Gray, K.C., Palacios, D.S., Dailey, I., Endo, M.M., ,42: 509-516. Uno, B.E., Wilcock, B.C., Burke, M.D., 2012. 29.Martins, M., Henriques, M., Ribeiro, A.P., Amphotericin primarily kills yeast by simply Fernandes, R., Goncalves, V., Seabra, A., Azeredo, binding ergosterol. Proceedings of the National J., Oliveira, R., 2010. Oral Candida carriage of Academy of Sciences, 109: 2234-2239. patients attending a dental clinic in Braga, 20.Grimoud, A.M., Marty, N., Bocquet, H., Andrieu, Portugal. Rev Iberoam Micol, 27: 119-24. S., Lodter, J.P., Chabanon, G., 2003. Colonization 30.Nikawa, H., Hamada, T., Yamamoto, T., 1998. of the oral cavity by Candidaspecies: risk factors Denture Plaque--Past and Recent Concerns. J in long-term geriatric care. Journal of Oral Dent, 26(4):299-304. Science, 45: 51-55. 31.Pereira-Cenci, T., Del Bel Cury, A.A., Crielaard, 21.Henriques, M., Azeredo, J., Oliveira, R., 2004. W., Ten Cate, J.M., 2008. Development of Adhesion of Candida albicans and Candida Candida-associated denture stomatitis: new dubliniensis to acrylic and hydroxyapatite. insights. Journal of Applied Oral Science, 16: 86- 52 JMR (Sep.2014), 1(1)