Fungal Diversity Portalia gen. nov. (Ustilaginomycotina) V. González1*, K. Vánky2, G. Platas3 and M. Lutz4 1Dept. Protección Vegetal y Biotecnología, Instituto Valenciano de Investigaciones Agrarias (IVIA), Carretera Moncada-Náquera, Km 4.5, 46113 Moncada (Valencia), Spain 2Herbarium Ustilaginales Vánky (HUV), Gabriel-Biel-Str. 5, D-72076 Tübingen, Germany 3Centro de Investigación Básica de España (CIBE), Merck, Sharp and Dohme España, S.A., Josefa Valcarcel, 38, E-28027 Madrid, Spain 4Universität Tübingen Spezielle Botanik/Mykologie Auf der Morgenstelle 1 72076 Tübingen Germany González, V., Vánky, K., Platas, G. and Lutz, M. (2007). Portalia gen. nov. (Ustilaginomycotina). Fungal Diversity 27: 45-59. A new, monotypic genus, Portalia is described for Cintractia uljanishcheviana, a smut fungus collected for the first time in Europe (Spain), in addition to its type locality in Kazakhstan. The phylogenetic relationship of the new genus to other smut genera, such as Cintractia, Dermatosorus, Gymnocintractia, Leucocintractia, Parvulago, Pilocintractia and Stegocintractia is discussed, based on ribosomal DNA LSU sequence analyses. A detailed description, including spore germination, obtained for the first time, as well as illustrations are given for Portalia uljanishcheviana. Key words: new combination, new genus, LSU rDNA, molecular phylogeny, Portalia, P. uljanishcheviana, Scirpus, smut fungi, taxonomy, Ustilaginomycotina Introduction Schwarzman (1960: 162) described a new smut fungus from Kazakhstan, Cintractia uljanishcheviana, in the 'ovaries' of Holoschoenus vulgaris Link (= Scirpus holoschoenus L., Cyperaceae). It is characterised by black spore masses and single, brown, verrucose, rather agglutinated spores. At that time, the genus Cintractia Cornu was heterogeneous and all smut fungi with black, agglutinated spore masses with single spores were included. Based on the 2- celled basidia, Brefeld (1895: 144) separated the genus Anthracoidea, but it was neglected until reinstated by Kukkonen (1963). Similar smut fungi, which were not on host plants in the Cyperaceae, were also removed from Cintractia (comp.Vánky, 1987). Based on morphological and molecular data Piepenbring et al. (1999), and Piepenbring (2000) split the large, heterogeneous Cintractia into four genera, recognising also Anthracoidea. Piepenbring (2000: 362) *Corresponding author: V. González; e-mail: [email protected] 45 considered C. uljanishcheviana to be a species of Anthracoidea, but did not make a combination into Anthracoidea. In 2004 a smut fungus was collected in Spain by V. González et al. on Scirpus holoschoenus. In molecular analyses it clustered with Dermatosorus cyperi and Parvulago marina. Morphological studies showed that it is identical with "Cintractia" uljanishcheviana, for which a new genus is proposed. Materials and methods Specimens examined Sorus and spore characteristics were studied using either dried herbarium specimens (preserved partly in Herbarium Ustilaginales Vánky, HUV 12116), or freshly collected material from Spain, [Cuenca Prov., Huete, road CM 2025 Sacedón-Huete, Arroyo Valquemado, 40º09'58.44'' N, 2º40'49.5'' W, alt. 720 m, 4.V.2004, leg. V. González, G. García and A. Quintanar, on dried, past years inflorescences of Scirpus holoschoenus (HUV 21361); ibidem, 8.VIII.2006, leg. V. González (HUV 21372)]. For light microscopy (LM) and spore measurements, dried spores were rehydrated in lactophenol by gently heating to boiling point. For scanning electron microscopy (SEM), dried spores were dusted on double-sided adhesive tape, mounted on a specimen stub, sputter-coated with gold-palladium, ca. 20 nm, and examined in a SEM at 10 kV. Spore germination was studied on water agar (WA), at room temperature. The spores were either collected from plants that were stored outdoor over the winter, or freshly collected spores were suspended in distilled water, kept at – 20°C for 12 hours and then dispersed on WA. DNA extraction, PCR amplification, and DNA sequencing For DNA extraction, two thirds of the cone shaped bottom of an Eppendorf tube was filled with spores of Portalia uljanishcheviana, and processed as previously described (Peláez et al., 1996). Amplification of the ITS2-D1-D2 region of the 28S rDNA was carried out using the primers ANT-1 5' CAACTTTTGGCAACGGATCTC 3'a that matches a zone of the 5.8S gene of Ustilaginales and NL4 (O'Donnell, 1993). PCR reactions were performed following standard procedures recommended by the manufacturer (5 minutes at 93ºC followed by 40 cycles of 30 s at 93ºC, 30 s at 53ºC and 2 min at 72ºC) with Taq DNA polymerase (QBiogene, Inc.). The amplification products (0.10 µg/ml) were sequenced 46 Fungal Diversity using the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems) following the manufacturer’s recommendations. Amplification products were sequenced with the same primers used for the initial amplification plus NL1 (O'Donnell, 1993). Partial sequences obtained in sequencing reactions were assembled using Bioedit 7.0.5.3 (Hall, 1999). The sequence obtained was compared to GenBank database using FastA applications (GCG Wisconsin Package, Version 10.3-UNIX, Accelrys Inc.). To get insight into the phylogenetic relationships of Portalia and other members of the Ustilaginomycetes, other D1-D2 28S rDNA sequences of taxa from both the Ustilaginales and the Urocystales were included in the analyses. In addition, three sequences representing Eballistra species (Exobasidiomycetes) were included to root the phylogenetic reconstructions. GenBank accession numbers are given in Fig. 5. Alignments of the homologous regions of the different strains were performed using the multiple alignment program ClustalW (Thompson et al., 1994). The final size of the alignment was 533 bases. Phylogenetic analysis Phylogenetic analyses were performed using sequences obtained by the authors and mostly retrieved from GenBank public databases, representing genera and species of several families of the Ustilaginales. All the LSU sequences employed are listed in Table 1. Bayesian analysis based on Markov Monte Carlo chain approach was run as implemented in the computer program MrBayes 3.01 (Huelsenbeck et al., 2002). To improve mixing of the chain, four incrementally heated simultaneous Monte Carlo Markov chains were run over 2,000,000 generations. MrModeltest 2.2 (Nylander, 2004) was used to perform hierarchical likelihood ratio tests to calculate the akaike information criterion (AIC) values of the nucleotide substitution models. The model selected by AIC for the present alignment was the GTR+I+G model of DNA substitution considering a proportion of invariable sites for the substitution rates, number of substitution rates = 6. Trees were sampled every 100 generations, resulting in an overall sampling of 20,001 trees. The initial 1001 trees were not used for the posterior analysis. From those trees that were sampled after the process had reached stationarity, a 50% majority-rule consensus tree was computed to get estimates for a posteriori probabilities. For the Maximum Likelihood analyses, MODELTEST (Posada and Crandall, 1998) was used to identify the model of DNA substitution that best fits. MODELTEST analyses selected the GTR+I+G model with the estimation of nucleotide frequencies (A = 0.2601, C = 0.1954, G = 0.21926, T = 0.3043) 47 Table 1. Sequences used in this study. Species Genbank Strain no. Original Substrate Reference accesion number Cintractia amazonica Syd. & P. Syd. AJ236142 MP 2008 Rhynchospora barbata Piepenbring et al., 1999 (Vahl) Kunth Cintractia axicola (Berk.) Cornu AF009847 HUV 17460 Fimbristylis tetragona R. Br. Begerow et al., 1997 Cintractia limitata G.P. Clinton AJ236147 MP 1310 Cyperus rotundus L. Piepenbring et al., 1999 Cintractia limitata G.P. Clinton AJ236146 MP 1594 Cyperus ligularis L. Piepenbring et al., 1999 Cintractia michellii Vánky AJ236149 HUV 17666 Fimbristylis schultzii Boeck. Piepenbring et al., 1999 Dermatosorus cyperi Vánky AJ236157 HUV 15991 Cyperus celluloso- Piepenbring et al., 1999 reticulatus Boeckeler Eballistra brachiariae (Viégas) R. Bauer, Begerow, A. AF009864 FO 17510 Brachiaria distycha (L.) Begerow et al., 1997 Nagler & Oberw. Stapf Eballistra lineata (Cooke) R. Bauer, Begerow, A. AY525372 HUV 741 Zizania aquatica var. Bauer et al., 2005 Nagler & Oberw. angustifolia (Hitchc.) Tsvelev Eballistra oryzae (Syd. & P. Syd.) R. Bauer, Begerow, AF229353 Isolate Oryza sativa L. Bauer et al., 2005 A. Nagler & Oberw. 127114 Eriomoeszia eriocauli (G.P. Clinton) Vánky AY740094 MS246 Eriocaulon cinereum R. Br. Stoll et al., 2005 Farysia chardoniana Zundel AF009859 MP 2062 Carex polystachya Swartz ex Begerow et al., 1997 Wahlenb. Heterotolyposporium piluliforme (Berk.) Vánky AF009871 HUV 15732 Juncus planifolius R. Br. Begerow et al., 1997 Leucocontractia leucodermoides (Berk.) M. Piepenbr., AJ236145 MP 2026 Rhynchospora Piepenbring et al., 1999 Begerow & Oberw. holoschoenoides (L.C. Rich.) Herter Leucocontractia scleriae (DC.) M. Piepenbr., Begerow AJ236154 MP 2074 Rhynchospora triflora Vahl Piepenbring et al., 1999 & Oberw. Macalpinomyces eragrostiellae Vánky & C. Vánky AY740089 MS80 Eragrostiella bifaria (Vahl) Stoll et al., 2005 Bor 48 Fungal Diversity Table 1 continued. Sequences used in this study. Species Genbank Strain no. Original Substrate Reference accesion number Macalpinomyces eriachnes (Thüm.) Langdon & Full. AY740090 MS293 Eriachne aristidea F. Stoll et al., 2005 Mueller Macalpinomyces eriachnes (Thüm.) Langdon & Full. AY740091 MS294 Eriachne helmsii (Domin) Stoll et al., 2005 Harley Melanotaenium cingens Bref. DQ875364 Isolate 1943 Linaria vulgaris Mill. Unpublished Melanotaenium euphorbiae (L.W. Lenz) M.D. AJ236135 HUV 17733 Euphorbia heterophylla L. Piepenbring et al., 1999 Whitehead & Thirum. Melanotaenium endogenum (Unger) de Bary DQ789979 CBS 481.91 Galium mollugo L. Unpublished Moreaua rhynchosporae-cephalotis (Vánky & T. AJ236160 HUV 15199 Rhynchospora cephalotes Piepenbring et al., 1999 Vánky) Vánky (L.) Vahl Parvulago marina (Durieu) R. Bauer, M. Lutz, M. DQ185437 M, TUB Eleocharis parvula (Roem. Bauer et al. (unpublished) Piatek & Oberw. 012166 & Schult.) Link ex Bluff, Nees & Schauer Pilocintractia fimbristylidicola (Pavgi & Mundk.) AJ236143 MP 2213 Fimbristylis spadicea (L.) Piepenbring et al., 1999 Vánky Vahl Portalia uljanishcheviana (Schwarzman) V. González, EF118824 HUV 21361 Scirpus holoschoenus L. This work Vánky & G. Platas Schizonella cocconii (Morini) Liro AJ236158 DB 614 Carex flacca Schreber Piepenbring et al., 1999 Schizonella melanogramma (DC.) J. Schröt. AF009870 FO 37174 Carex pilulifera L. Begerow et al., 1997 Sporisorium apludae-aristatae (B.V. Patil & Thirum.) AY740098 MS287 Apluda mutica L. Stoll et al., 2005 Vánky Sporisorium cruentum (J.G. Kühn) Vánky AY74156 MS14 Sorghum bicolor (L.) Stoll et al., 2005 Moench Sprosorium destruens (Schltdl.) Vánky AY747077 MS133 Panicum miliaceum L. Stoll et al., 2005 Sprisorium fastigiatum Vánky AY740133 MS45 Andropogon angustatus (J. Stoll et al., 2005 Presl) Steud. 49 Table 1 continued. Sequences used in this study. Species Genbank Strain no. Original Substrate Reference accesion number Sporisorium foveolati (Maire) Vánky AY740103 MS21 Eremopogon foveolatus Stoll et al., 2005 Stapf Sporisorium loudetiae-pedicellatae Vánky & C. Vánky AY740106 MS252 Loudetia pedicellata (Stent.) Stoll et al., 2005 Chippind. Sprisorium moniliferum (Ellis & Everh.) L. Guo AF453940 MS 98 Heteropogon contortus (L.) Piepenbring et al., 2002 P. Beauv. ex Roem. & Schult. Sporisorium ophiuri (Henn.) Vánky AJ236136 HB 20 Rottboellia cochinchinesis Piepenbring et al., 1999 (Lour.)W.Clayton Sprisorium penniseti (Rabenh.) Ershad AY740130 MS5 Pennisetum setaceum Stoll et al., 2005 (Forsk.) Chiov. Sporisorium sorghi Ehrenb. ex Link. AY745726 CBS104.17 unknown Unpublished Sprisorium sorghi Ehrenb. ex Link AF009872 Isolate 1056 Sorghum bicolor (L.) Begerow et al., 1997 Moench Sporisorium veracruzianum (Zundel & Dunlap) M. AY740114 Isolate 1335 Panicum viscidellum Scribn. Stoll et al., 2005 Piepenbr. Stegocintractia luzulae (Sacc.) M. Piepenbr., Begerow AJ236148 MP 2340 Luzula pilosa (L.) Willd. Piepenbring et al., 1999 & Oberw. Stegocintractia spadicea (Liro) M. Piepenbr. & AJ236155 MP 2350 Luzula alpinopilosa (Chaix) Piepenbring et al., 1999 Begerow Breistr. Tolyposporium junci (J. Schröt.) Woronin AF009876 HUV 17168 Juncus bufonius L. Begerow et al., 1997 Trichocintractia utriculicula (Henn.) M. Piepenbr. AF009877 MP 2075 Rhynchospora corymbosa Begerow et al., 1997 (L.) Britton Ustanciosporium cubense (M. Piepenbr.) M. Piepenbr. AJ236153 MP 2252 Rhynhospora microcephala Piepenbring et al., 1999 & Begerow Britton Ustanciosporium montagnei (Tul. & C. Tul.) M. AJ236150 MP 2344 Rhynchospora alba (L.) Piepenbring et al., 1999 Piepenbr., Begerow & Oberw. Vahl 50 Fungal Diversity Table 1 continued. Sequences used in this study. Species Genbank Strain no. Original Substrate Reference accesion number Ustanciosporium neomontagnei M. Piepenbr. & AJ236151 MP 925 Rhynchospora globosa Piepenbring et al., 1999 Begerow (Kunth) Roem & Schult. Ustanciosporium rhynchosporae Vánky AJ236144 MP 2335 Rhynchospora alba (L.) Piepenbring et al., 1999 Vahl Ustanciosporium samanense (Cif.) M. Piepenbr. AJ236152 MP 2106 Rhynchopsora fascicularis Piepenbring et al., 1999 (Michx.) Vahl ssp. fascicularis Ustanciosporium standleyanum (Zundel) M. Piepenbr. DQ846888 JAG 73 unknown Unpublished Ustanciosporium taubertianum (Henn.) M. Piepenbr. DQ839599 HAJB10528 unknown Unpublished & Begerow Ustanciosporium taubertianum (Henn.) M. Piepenbr. AJ236156 MP 1801 Rhynchospora tenuis Link Piepenbring et al., 1999 & Begerow Websdanea lygniae (Websdane, Sivasith., K.W. Dixon AJ236159 HUV 17900 Lyginia barbata (Labill.) Piepenbring et al., 1999 & Pate) Vánky R.Br. 51 with the shape parameter of the gamma distribution (a = 0.6237) to accommodate rate variations among sites. Maximum Likelihood analysis was performed with PAUP 4.0. The starting tree was obtained via neighbour- joining; the branch-swapping algorithm used was TBR. The multiple alignment and phylogenetic tree performed with Bayesian analysis were deposited on TREEBASE under the number SN3137. Results Two phylogenetic reconstructions based on the comparison of D1-D2 28S rDNA sequences were made employing Bayesian (BY) and Maximum Likelihood (ML) analyses. This was done to obtain an accurate view on the systematic relationships between Portalia, the new smut genus here proposed, and several related smut fungi such as Cintractia s. l., including genera recently segregated from this genus on the basis of molecular and morphological evidence (Piepenbring et al., 1999), and some other smut genera belonging to the Ustilaginales and the Urocystales. Thus, molecular analyses covered several genera in the Ustilaginales (Sporisorium, Moreaua, Dermatosorus, Farysia, Eriomoeszia, Macalpinomyces and Websdanea), plus one genus, Melanotaenium, presently considered within the order Urocystales. Topologies resolved by means of Maximum Likelihood analysis were identical (data not shown) to those obtained with Bayesian methods. Thus, results described and further discussion is based on the phylogram obtained with Bayesian analysis. Phylogenetic analysis of the D1 and D2 domains of the LSU rDNA (Fig. 5) provided evidence to consider "Cintractia" uljanishcheviana to be outside the genus Cintractia. The LSU sequence representing "Cintractia" uljanishcheviana clustered together with sequences representing two other members of the Ustilaginales with an uncertain systematic placement: Ustilago marina Durieu (= Parvulago marina) and Dermatosorus cyperi Vánky. The latter, a peculiar smut fungus recently accommodated (Vánky, 2001) in the family Dermatosoraceae, was revealed (with a support of 95%) as sister taxon to “Cintractia” uljanishcheviana. Parvulago was recently erected (M. Lutz, pers. comm., in prep.) to accommodate Ustilago marina (on Eleocharis parvula), a taxon that exhibits morphological and molecular features different to those accepted for the modern concept of the large and complex genus Ustilago. Furthermore, phylogenetic reconstruction suggests a polyphyletic origin for both the Ustilaginaceae and the Cintractiaceae. Thus, topology resolved in 52 Fungal Diversity the Bayesian analysis (Fig. 5), showed several main clusters, where genera from these two families grouped and were distributed and partly also mixed. All the species belonging to Cintractia s. str. clustered in a single clade on a basal position with the rest of the genera analyzed. Such topology validates the prevailing view that considered this family as a polyphyletic and heterogeneous group. Some allied, recently segregated genera, such as Stegocintractia, Ustanciosporium and Leucocintractia (Piepenbring et al., 1999) appeared not closely related and even distant (in the case of Stegocintractia) with the rest of the taxa included in the Cintractia s. str. “core” clade resolved in Fig. 5. Phylogenetic reconstruction also provided evidence to consider Pilocintractia fimbristylidicola, a taxon recently removed (Vánky, 2004) from the concept of Cintractia s. str. Topology obtained here arranged P. fimbristylidicola on a single branch, external and not related with Cintractia or any of the recently segregated Cintractia-like genera. Furthermore, one sequence representing Eriomoeszia eriocauli (= Moesziomyces eriocauli) (Vánky, 2005) was found to group together with P. fimbristylidicola but clustering on a separate branch. Discussion On account of the molecular and morphometrical evidence (including morphology, cytology and teliospore germination) provided here, the new genus Portalia could be considered as a natural taxon of the Ustilaginales, being removed out of the concept of genus Cintractia s. l. The relative position of the isolate of P. uljanishcheviana in the pyhlogenetic reconstruction (Fig. 5) suggested that Portalia is not closely related to Cintractia, nor with any of the several Cintractia-like genera recently erected. Considering Dermatosorus cyperi and Parvulago marina, the species which were revealed as closest relatives of Portalia in the molecular analyses, the morphology of the types of these three genera is so markedly different (for Ustilago marina comp. Vánky, 1994:366 and 417, for Dermatosorus comp. Vánky, 2002:44-45) that we consider the erection of a new genus for Cintractia uljanishcheviana is justified. Concerning the family concept for the Ustilaginaceae, current systematic schemes based on morphological features and host relationships do not fit well with molecular-based grouping provided here and in previous phylogenetic studies (e.g. Begerow et al., 1997; Piepenbring et al., 1999; Stoll et al., 2005; Vánky et al., 2006). There is no molecular support to consider the Cintractiaceae as a monophyletic group. Thus, we prefer to retain all those 53 genera (representing the Ustilaginaceae, Cintractiaceae, Dermatosoraceae and Farysiaceae) under a big and extensive concept of Ustilaginaceae until more indepth combined analyses suggest more stable taxonomical conclusions within the group. In summary, molecular analyses performed have: 1) provided evidence for considering the new genus Portalia as a natural taxon within the Ustilaginales; 2) supported the previously assumed heterogeneity of the Ustilaginaceae; 3) suggested a possible polyphyletic origin for the family Cintractiaceae; and 4) not fully resolve the systematic placement of P. uljanishcheviana within the Cintractiaceae. As a result of our morphological and molecular biology investigations of Cintractia uljanishcheviana we propose the erection of a new genus: Portalia V. González, Vánky & G. Platas, gen. nov. MycoBank: 510390. Etymology: Portalia derived from the name María Ángeles Portal, the wife of Dr. Vicente González. Sori in floribus familiae Cyperaceae (Scirpus), sine peridio et stromate fungali, e massa sporarum nigra, mature pulverea, e sporis tantum compositi, sine cellulis sterilibus. Infectio systemica. Sporae singulares, pigmentatae (brunneae), ornamentatae. Germinatio sporarum basidiis septatis (phragmobasidiis) cellulis eorum compatibilibus fusis hyphae dicaryoticae producentibus. Typus generis: Sori in the flowers of Cyperaceae (Scirpus), peridium and fungal stroma lacking, spore mass black, when mature powdery, composed of spores only, no sterile cells. Infection systemic. Spores single, pigmented (brown), ornamented. Spore germination results in septate basidia (phragmobasidia) of which compatible cells fuse producing dikaryotic hyphae. Portalia uljanishcheviana (Schwarzman) V. González, Vánky & G. Platas, comb. nov. (Figs 1-4) Basionym (≡): Cintractia uljanishcheviana Schwarzman, Fl. spor. rast. Kazakhstana 2: 162, 1960 (as "uljanishchevianum"). — Type on Holoschoenus vulgaris (= Scirpus holoschoenus), Kazakhstan, Dzhambulskaya Obl., Ul'kun-Burul, Lake Bijlikul, 12.VII.1949, S.R. Schwarzman. Holotype in AA, isotype in HUV 12116. Sori in the flowers, usually affecting all in a spikelet, destroying the innermost floral organs replacing them by a black, semiagglutinated to powdery mass of spores completely hidden by the outermost floral envelopes. Peridium and stroma lacking. Infected spikelets swollen, globoid or ovoid, 1-2 mm in diameter. Infection systemic; all spikelets (or nearly all) (Fig. 1b) of a head, and all heads of an inflorescence are affected (Fig. 1a). Spores (Figs 2, 3) single, 54