1 Running title: Plum pox virus and oxidative stress in apricot Correspondence to: Dr. José A. Hernández Centro de Edafología y Biología Aplicada del Segura CSIC Department of Plant Breeding, Apdo. 164 E-30100 Espinardo (Murcia) SPAIN FAX: 34 968 396213 E-mail: [email protected] 2 Long-term Plum Pox Virus infection produces an oxidative stress in a susceptible apricot (Prunus armeniaca L.) cultivar but not in a resistant cultivar José Antonio Hernández a,*, Pedro Díaz-Vivancos a, Manuel Rubio a, Enrique Olmosb, Alfonso Ros- Barcelóc A. And Pedro Martínez-Gómeza aDepartment of Plant Breeding CEBAS-CSIC. P.O. Box 164, 30100 Espinardo-Murcia, Spain. bDepartment of Plant Nutrition CEBAS-CSIC. P.O. Box 164, 30100 Espinardo-Murcia, Spain cDepartment of Plant Biology (Plant Physiology), University of Murcia, E-30100 Murcia (Spain) 3 Abstract The effect of Plum pox virus (PPV) infection on the response of some antioxidant enzymes was studied in two apricot cultivars, which behaved differently against PPV infection: cv. Real Fino (susceptible) and cv. Stark Early Orange (SEO, resistant). In the susceptible cultivar, PPV produced a decrease in (cid:1) , F’ /F’ and Q . PPV infection produced a drop in pHMB-sensitive ascorbate PSII v m p peroxidase, dehydroascorbate reductase and peroxidase in the soluble fraction from susceptible plants, whereas in the resistant apricot cultivar pHMB-insensitive ascorbate peroxidase, monodehydroascorbate reductase, glutathione reductase and superoxide dismutase increased. However, catalase decreased in the soluble fraction from both infected cultivars. Long-term PPV infection also produced a decrease in the chloroplastic ascorbate-glutathione cycle enzymes only in the susceptible plants. As a consequence of PPV infection, an oxidative stress, indicated by an increase in lipid peroxidation and in protein oxidation, was produced only in the leaves from the susceptible cultivar which was also monitored by the diaminobenzidine-peroxidase coupled H O 2 2 probe. The loss of (cid:1) , indicative of AOS production, and the decrease in the levels of antioxidant PSII enzymes in chloroplasts from susceptible plants, could be responsible for the chlorosis symptoms observed. The results suggest that the higher antioxidant capacity showed by cultivar SEO could be a consequence of a systemic acquired resistance induced by PPV penetration in stem tissue at the graft site and could be related, among other factors, to their resistance to PPV. Key Words: Apricot, antioxidant enzymes, oxidative stress, plum pox virus, virus resistance, photochemical quenching, Prunus, ultrastructure Abbreviations - ASC, ascorbate; AOS, activated oxygen species; ASC-GSH cycle, ascorbate- glutathione cycle; APX, ascorbate peroxidase; CO-protein, carbonil proteins contents; cv. SEO, cv. Stark Early Orange; DHAR, dehydroascorbate reductase; F /F , maximum quantum yield of v m photosystem II; F’ /F’ , efficiency of excitation energy capture by PSII; GR, glutathione reductase; v m MDHAR, monodehydroascorbate reductase; 4-MN, 4-methoxy-1-naphthol; NPQ, non- photochemical quenching; 1O ; singlet oxygen; .OH, hydroxyl radical; O .-, superoxide radical; 2 2 pHMB, p-hydroxy mercury benzoic acid; PPV, plum pox virus; q ; photochemical quenching; SOD p superoxide dismutase; TBARS, thiobarbituric acid-reactive substances; (cid:1) , quantum yield of PSII photosystem II photochemistry. 4 Introduction Sharka, a disease caused by Plum pox virus (PPV) is a serious limiting factor for temperate fruit production in affected areas, resulting in severe economic losses in Prunus species including apricot and peach (Kölber 2001). Obtaining Prunus cultivars resistant to sharka is one of the main objectives of breeders, but the evaluation of programmes for PPV resistance is time-consuming and very expensive (Martínez-Gómez and Dicenta 2000a). Therefore, biochemical and molecular markers associated with resistance would be of great interest. These markers will improve the selection process in the evaluation of a higher number of individuals. In most incompatible interactions, the rapid induction of highly-localised events imposes unfavourable conditions for pathogen growth. This defence response culminates in a localized cell death, called the hypersensitive response (HR), associated with the resistance to pathogen spread (De Gara et al. 2003). Increased levels of activated oxygen species (AOS), including superoxide (O .-) and hydrogen peroxide (H O ), built up by either enhanced production or decreased 2 2 2 scavenging potential, may contribute to the resistance reaction to pathogens in incompatible reactions (Alvarez et al. 1988, Adams et al. 1989, Doke and Ohashi, 1988, Thordal-Christensen et al.1997). However, very little is known about the oxidative metabolism in plant resistance reactions to pathogens that do not induce the HR, such as the necrotrophic fungi that invade the plant vascular system (García-Limones et al. 2002) or some plant viruses such as PPV (Hernández et al. 2001a, 2003, 2004b). Alternatively, increased levels of AOS could also contribute to the symptom development and pathogenesis in compatible plant-virus interactions, as described recently in PPV- susceptible peach plants (Hernández et al. 2003, 2004b) and in CMV-infected Cucumis sativus and ZYMV-infected Cucurbita pepo plants (Riedle-Bauer 2000). In recent work carried out in our laboratory, we showed that long-term PPV infection produced an oxidative stress in leaves of peach cv. GF305, characterised by its high susceptibility to PPV, manifested as increases in lipid peroxidation and protein oxidation, the appearance of oxidative microbursts and effects on chloroplast ultrastructure (Hernández et al. 2004b). 5 Plants, like other aerobic organisms, are endowed with efficient AOS-scavenging mechanisms. The primary components of these antioxidant systems include non-enzymatic antioxidants (carotenoids, ascorbate, glutathione and tocopherols) and enzymes such as SOD, catalase (EC 1.11.1.6), glutathione peroxidase (GPX, EC 1.11.1.9), peroxidases and the enzymes involved in the ascorbate-glutathione cycle (ASC-GSH cycle): ascorbate peroxidase (APX, EC 1.11.1.1), dehydroascorbate reductase (DHAR, EC 1.8.5.1), monodehydroascorbate reductase (MDHAR, EC 1.6.5.4) and glutathione reductase (GR, EC 1.6.4.2). The components of this antioxidant defence system can be found in different subcellular compartments (Jiménez et al. 1998, Hernández et al. 2000), and they are constitutively expressed to cope with AOS formed under normal conditions. However, they can also be induced to maintain the lowest possible levels of AOS under both biotic and abiotic stresses (Hernández et al. 2000, 2001b, García-Limones et al. 2002). An increasing amount of data supports the hypothesis that a fine regulation of antioxidant systems is part of the signalling pathways which activate defense responses. However, the diversity in the systems used for studying plant-pathogen interplay makes it difficult to formulate a clear picture of whether, and to what extent, changes in antioxidant systems are directly involved in plants defense responses or are a mere consequence of the oxidative stress occurring in the attacked cells (de Gara et al. 2003). Several lines of evidence support the regulatory role that cellular antioxidants, especially GSH and GSH-related enzymes, play in the biochemical and physiological responses of plants to biotic stress (Gullner et al. 1999, Fodor et al. 1997). In this sense, the artificial elevation of cellular GSH and the activation of GSH-related enzymes can markedly suppress necrotic disease symptoms and in some cases also virus multiplication (Gullner et al. 1999). In a recent paper, it has been proposed that a decline in AOS-scavenging capacity may be required before a rapid increase in virus replication can take place. Phaseolus vulgaris L. plants treated with the cytokinin dihydrozeatin, salicylic acid or jasmonic acid showed elevated catalase, GR and peroxidase activities. These treatments, when applied before inoculation with the 6 Potexvirus White clover mosaic virus, inhibited virus replication and symptom development (Clarke et al. 2002). In woody plant species, such as apricot, different factors, including their lignified nature, the inoculation method, and the cycle of growth with periods of dormancy, make the study of the early response to virus inoculation very difficult. In this work, the effect of long-term PPV infection on the activity of antioxidant enzymes from apricot cvs. “Real Fino” (susceptible to PPV) and “SEO” (resistant to PPV) at subcellular levels (cytosol and chloroplasts) was studied. The extent of lipid peroxidation and protein oxidation, the histochemical detection of H O and the leaf ultrastructure 2 2 were also analysed, to determine whether oxidative stress is involved in the development of symptoms and the pathogenesis of PPV-susceptible apricot plants. MATERIAL AND METHODS Plant Material Plant material assayed included the North American apricot cultivar SEO, characterised as resistant to PPV, and the Spanish cultivar Real Fino, described as susceptible against virus (Martínez-Gómez and Dicenta 2000a). Apricot seedlings were grafted on peach GF305 plants, characterised by its susceptibility to fruit viruses including PPV (Bernhard et al. 1969) and usually used as a rootstock in PPV-resistance tests on Prunus, both in vivo (Martínez-Gómez and Dicenta 2000a) and in vitro (Martínez-Gómez and Dicenta 2000b). Ten repetitions from each apricot cultivar were grafted onto control or infected GF305 rootstocks. Another ten repetitions were kept as control. Two months after inoculation, seedlings were subjected to an artificial rest period, in a cold chamber at 7 °C, in darkness for six weeks. Plants were then transferred to an insect-proof greenhouse, and were grown in 2-litre potsin controlled conditions.Plants were inspected for sharka symptoms 4 weeks after the sprouting of the buds. Two cycles of growth (two month in the cold chamber and four months in the greenhouse) per year were analysed, and at least two experiments per cycle was performed. Data were recorded over two years periods.The environmental conditions in the greenhouse were: temperature between 7 15º and 30ºC during all the year due to the control of temperatures during the summer with a refrigeration systems, and relative humidity of 60-80%, with a photoperiod of around 16 hour of light. PPV isolate The PPV isolate used was RB3.30, a Dideron Type isolate obtained from the Red Beaut plum cultivar in Spain, from the PPV collection of the Instituto Valenciano de Investigaciones Agrarias (IVIA) in Valencia (Spain). This isolate is considered to be representative of the Spanish PPV population and produces strong sharka symptoms in young leaves, consisting of veinal chlorosis in peach GF305 and veinal chlorosis and rings in susceptible apricot leaves (Pelet and Bovey 1968). PPV inoculation procedure Ten apricot scions per genotype were propagated onto control (healthy) and inoculated (infected) symptomatic GF305 peach seedlings, one scion per seedling. Scion-grafted trees were forced into dormancy by subjecting them to 7 ºC and darkness for two months. After this cold-dark treatment, trees were transferred to an insect-proof greenhouse and were inspected for sharka symptoms four weeks later. Two cycles of growth were performed over a one-year period. Only plants where the GF305 rootstock showed clear PPV symptoms were considered to be successfully inoculated. During each growth cycle, the presence of symptoms in leaves was scored in each leaf of each plant according to a scale from 0 (no symptoms) to 5 (maximum intensity of symptoms), scale usually used in the studies of resistance evaluation in apricot (Martínez-Gómez and Dicenta 2000a). ELISA-DASI test During the two growth cycles, to verify the presence or absence of the virus an ELISA-DASI (Double Antibody Sandwich Indirect) was applied to the leaves using 5B monoclonal antibodies (Asensio 1996) against the capside protein of the PPV according with the protocol of Cambra et al. (1994). 8 Samples were incubated at 5 °C for 16 h with polyclonal rabbit antibodies (Real-Durviz. Valencia, Spain) 1.42 µg/ml in 1% (w/v) Bovine Serum Albumin (BSA) (Boehringer&Mannhein. Barcelona, Spain)-PBS (0.08% ClNa, 0.002% KH PO , 0.3% Na HPO 12H O, 0.02% CLK). After washing 3 2 4 2 4 2 times for 5 min with PBS-Tween-20 (0.5 ml/l Tween-20) the micro-plates were incubated in 1% (w/v) BSA-PBS with the specific monoclonal antibodies (0.1 µg/ml) (Real-Durviz) at 37 °C for 2h. After washing 3 times with PBS-Tween-20 samples were incubated in 1% (w/v) BSA-PBS with alkaline phosphatase-labeled second antibody (0.1 µg/ml) (Real-Durviz) at 37 °C for 2h. Then, micro-plates were washed again three times (PBS-Tween-20) and were reveled with p-nitrofenolphosphate colorimetric substrate (Sigma), recording the optical densities (OD) at 405 nm for 60 min. In accordance with Sutula et al. (1986), samples with OD double that of the healthy control were considered ELISA-positive. RT-PCR analysis RT-PCR analysis was carried out during the two cycles of study using total RNA extracted with the Rneasy Plant Mini Kit (Qiagen, Hilden, Germany), as described by MacKenzie et al. (1997). Two specific primers within the coat protein (CP) gene, VP337 (CTCTGTGTCCTCTTCTTGTG) complementary to 9487-9508 positions of genomic PPV and VP338 (CAATAAAGCCATTGTTGGATC) homologous to 9194-9216 positions, were assayed (Martínez- Gómez et al. 2003). PCR parameters were: one cycle at 94ºC for 2 min followed by 30 cycles of 94ºC for 30 sec, 55ºC for 30 sec and 72ºC for 30 sec, and finally an extension temperature of 72ºC for 5 min (Martínez-Gómez et al. 2003). Amplified products were electrophoresed in 1% agarose gels in 40 mM Tris-acetate and 1 mM EDTA, pH 8.0 (TAE), and stained with ethidium bromide. A 1 Kb Plus DNA Ladder (InvitrogenTM Life Technologies) was used as molecular size standard. 9 Fluorescence measurements Ten control and ten PPV-infected peach plants were analysed in each cycle. Modulated chlorophyll fluorescence was measured in dark-adapted peach leaves at midday, using an OS-30 chlorophyll fluorometer (Optisciences, USA) with an excitation source intensity of 2000 µmol m-2 s-1. The quantum yield of photosystem II photochemistry ((cid:1) ) was calculated empirically as the PSII fluorescence parameter (F ’ – F)/F ’ (Genty et al. 1989), and the maximum quantum yield of m t m photosystem II (F /F ) as (F – F )/F (Maxwell and Johnson 2000). Non-photochemical v m m o m quenching (NPQ) was calculated as a Stern-Vollmer-type quenching (Bilger and Björkman 1990). The photochemical quenching coefficient, equivalent to the fraction of open PSII reaction centres, was calculated as q = (F’ -F)/(F’ -F’ ) (Maxwell and Johnson 2000). p m t m o The efficiency of excitation energy capture by PSII, corresponding to the probability that an absorbed photon reaches the PSII reaction centres, was calculated in light-adapted leaves as F’ /F’ = (F’ -F’ )/F’ v m m o m. The minimal “dark” fluorescence level following illumination (F ’) was measured in the presence of o a background far-red light, to favour rapid oxidation of intersystem electron carriers. Isolation of cell fractions For the isolation of cell fractions four weeks-old plants were used. All operations were carried out at 0-4 ºC. Soluble fractions were prepared by homogenising 3 g of fresh leaf material with a mortar and pestle, with 6 ml of a grinding medium containing 0.35 M mannitol, 30 mM MOPS buffer (pH 7.5), 4 mM L-cysteine, 1 mM EDTA, 5% insoluble PVPP (w/v) and 0.2% (w/v) BSA. For APX activity, 20 mM ascorbate was added. The homogenate was filtered through 2 layers of cheesecloth and centrifuged at 2200 g for 30 s, to pellet the chloroplast fraction. The supernatant was centrifuged at 12000 g, to discard mitochondria and peroxisomes. Then, the 12000 g supernatant was centrifuged for 20 min at 82000 g. The resulting supernatant obtained was partially purified, in Sephadex G-25 NAP columns (Amersham Pharmacia Biotech AB, Uppsala, Sweden) equilibrated with the same buffer 10 (with or without 2 mM ascorbate) used for homogenisation, and was considered as the soluble fraction for use in different assays (Hernández et al. 2004b). Chloroplasts were prepared by homogenising 5 g, of fresh leaf material, with a mortar and pestle, with 15 ml of a grinding medium containing 0.35 M mannitol, 30 mM MOPS buffer (pH 7.5), 4 mM L- cysteine, 1 mM EDTA, 5% soluble PVP (w/v) and 0.2% (w/v) BSA (Hernández et al. 2004b). For APX activity, 20 mM ascorbate was added. The homogenate was filtered through 2 layers of cheesecloth and centrifuged at 2200 g for 30 s; the resulting pellet was suspended in 0.3 M mannitol, 20 mM MOPS buffer (pH 7.0), 1 mM EDTA and 0.2% BSA (washing medium), with or without 2 mM ascorbate. The suspension was centrifuged at 2200 g for 30 s, and the pellet obtained was resuspended in 6 ml of the same washing medium. Resuspension medium containing 40% (v/v) Percoll (Amersham Pharmacia Biotech) was layered under the chloroplasts suspension by slowly pipetting 5 ml into the bottom of the tube (Hernández et al. 2004b). Tubes were centrifuged at 1700 g for 1 min. The pellet of intact chloroplasts was resuspended in 1 ml of washing medium, without BSA, and used for enzyme assays. Assays Catalase and the ASC-GSH cycle enzymes were measured as described in Hernandez et al. (1999, 2001a, 2001b). Total peroxidase was analysed according to Pomar et al. (2004). SOD activity was assayed by the ferricytochrome c method using xanthine/xanthine oxidase as the source of O .- radicals (McCord and Fridovich 1969). The extent of lipid peroxidation in leaves was 2 estimated by determining the concentration of substances reacting with thiobarbituric acid (TBARS) (Cakmak and Horst 1991). Protein carbonyl content (CO-proteins) was measured by reaction with 2,4-dinitrophenylhydrazine, as described by Levine et al. (1990). Histochemical detection of H O in peach leaves 2 2