Meenaetal.BMCMicrobiology2013,13:145 http://www.biomedcentral.com/1471-2180/13/145 RESEARCH ARTICLE Open Access Novel marine actinobacteria from emerald Andaman & Nicobar Islands: a prospective source for industrial and pharmaceutical byproducts Balakrishnan Meena1*†, Lawrance Anbu Rajan1†, Nambali Valsalan Vinithkumar1 and Ramalingam Kirubagaran2 Abstract Background: Andaman and Nicobar Islands situated inthe eastern part of Bay ofBengalare one ofthe distinguished biodiversity hotspot.Even though numberof studies carried out on themarine flora and fauna, the studies onactinobacteriafrom Andaman and Nicobar Islands are meager. The aim ofthepresent study was to screen theactinobacteria for their characterization and identify thepotential sources for industrial and pharmaceutical byproducts. Results: A total of 26 actinobacterial strains were isolated from the marine sedimentscollected from various sites of PortBlair Baywhere nocollection has been characterizedpreviously.Isolates were categorized under the genera: Saccharopolyspora,Streptomyces,Nocardiopsis,Streptoverticillium,Microtetraspora, Actinopolyspora, Actinokineospora and Dactylosporangium.Majority of the isolates were found to produce industrially important enzymes such as amylase, protease, gelatinase, lipase, DNase, cellulase, urease and phosphatase, and also exhibited substantial antibacterial activity against humanpathogens. 77% ofisolates exhibited significant hemolyticactivity.Among 26 isolates, three strains (NIOT-VKKMA02, NIOT-VKKMA22 and NIOT-VKKMA26) were found to generate appreciable extent ofsurfactant,amylase, cellulaseand protease enzyme. NIOT-VKKMA02 produced surfactant using kerosene as carbon source and emulsifiedupto E –63.6%. Moreover, NIOT-VKKMA02, NIOT-VKKMA22 and NIOT-VKKMA26 24 synthesized 13.27 U/ml, 9.85 U/ml and 8.03 U/ml amylase; 7.75 U/ml,5.01 U/ml and 2.08 U/ml of cellulase and 11.34U/ml,6.89 U/ml and 3.51 U/ml of protease enzyme, respectively. Conclusions: High diversity ofmarine actinobacteria was isolated and characterized inthis work including undescribed speciesand species not previously reported from emerald Andaman and Nicobar Islands, including Streptomyces griseus, Streptomyces venezuelae and Saccharopolysporasalina. The enhanced salt, pH and temperature tolerance of the actinobacterial isolates along withtheir capacity to secrete commercially valuable primary and secondary metabolites emerges as anattractive feature ofthese organisms. These results are reported for thefirst time from theseemerald Islands and expand thescope to functionallycharacterize novel marine actinobacteriaand their metabolites for thepotential novel molecules ofcommercialinterest. Keywords: Andaman & Nicobar Islands, Marine actinobacteria, Enzymatic activity, Hemolytic activity, Antibacterial activity *Correspondence:[email protected] †Equalcontributors 1AndamanandNicobarCentreforOceanScienceandTechnology, ESSO-NIOT,Dollygunj,PortBlair,AndamanandNicobarIslands744103,India Fulllistofauthorinformationisavailableattheendofthearticle ©2013Meenaetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited. Meenaetal.BMCMicrobiology2013,13:145 Page2of17 http://www.biomedcentral.com/1471-2180/13/145 Background research and their metabolites. Hence, there is an im- Actinobacteria, are filamentous Gram positive prokary- mense possibility to identify and functionally characte- otes with 67-78% G+C content [1]. Actinobacteria are rize new marine actinobacteria to identify novel bioactive considered as an intermediate group of bacteria and compounds. Accordingly, the present study at Port Blair fungi and are recognized as prokaryotic organisms. Ac- Bay of A & N Islands aimed to isolate and functionally tinobacteria are present in various ecological habitats characterize the marine actinobacteria of industrial and andmarineenvironments[2]andtocopewiththeenvir- pharmaceuticalinterestwiththe ultimateobjectiveofdis- onmental stress, marine microorganisms have developed coveringnovelbioactivecompounds. a complex stress management for their survival, which is being unrevealed for multiple purposes [3]. They are Methods being exploited for various commercial applications in Studyarea environmental, biomedical and industrial sectors [4]. A & N group of Islands is consisting of 572 islands from Various metabolites of actinobacterial origin have been Landfall Island to Great Nicobar stretches through the reported for their excellent bioactivity [5]. Marine envir- distance of 770 km length and covers an area of about onment is the prime reservoir of biological diversity and 8249 Km2. The study area Minnie Bay, Port Blair, South the marine microorganisms are recognized to be rich Andaman, is situated at the proximal end of the Port sources of novel compounds. In India, about 1000 nat- Blair Bay (Figure 1). Two major species of mangrove ural products were derived from marine microbes [6], in Rhizophora sp. and Avecenia sp. were making most of which, marine actinobacteria have been proven as a po- the boundary of the bay. The study area is affected by tentialsourceof bioactive compoundsandrichestsource the tidal amplitude of 1.5 to 2.0 m approximately. This of secondary metabolites. They are the most economic- Bay is found to be rich in nutrients due to the domestic allyandbiotechnologicallyvaluableprokaryotes. waste discharges from the residential complex and deg- Currently, enzymes and drugs from microbial origin radation of submerged mangrove vegetation after the are substituting the chemical catalysts in leather, food, tsunami incident in2004. paper, pharmaceuticals and textile industries [7]. Major- ity of the enzymes are derived from plants, animals and Collectionofsedimentsamples microorganisms. Among them, microbes are the top- Marine sediment samples were collected from Minnie most due to their rapid doubling time and enzyme pro- Bay using Global Positioning System (GARMIN eTrex duction when compared with plants or animals to meet Vista H, Taiwan) coordinates of 11°38“42.8”N lat. and the existing market demand for industrial enzymes [8]. 92°42“30.7”E long. Samples were collected randomly in Marine actinobacteria are capable of producing enzymes sterile polythene bags and transported immediately to with good stability at higher temperature and alkaline the laboratory for isolation of marine actinobacteria. conditions. Even though, the production of antibiotics as Based on the colony morphology, 26 distinct colonies major bioactive compounds from marine actinobacteria were selectedfor characterizationstudies. [4,9] the ability to synthesize variety of industrial en- zymes can be an attractive phenomenon to accomplish Measurementofphysico-chemicalparameters ourfuturedemand. The pH of sediment samples was measured as described A little is known about the diversity of actinobacteria previously by Ramesh and Mathivanan, [13]. Briefly, in marine sediments, which is an inexhaustible resource 10 g of each marine sediment samples were suspended that has not been properly exploited. Many reports sug- in 20 ml of distilled water and was allowed to stand gested that marine sediment is a rich source of acti- for 20 min to attain the equilibrium condition. Subse- nobacteria [10]. Andaman coast in India is holding quently, the pH was recorded using digital meter outsizeddiverseandunexploitedecosystemfortheisola- (Thermo Orion 420 A plus, USA) and salinity of the tion of novel actinobacteria with effective bioactive mol- samples was documented with a refractometer (ATAGO ecules [11]. The Andaman and Nicobar (A & N) Islands S/Milli-E, USA). Temperature, Dissolved Oxygen (DO) marine ecosystem are mostly unexplored, and may pro- and nutrients of the sampling site were documented as vide a rich source of microorganisms producing novel describedbyGrasshoffetal.[14]. andefficientantimicrobialcompounds[12].Onlylimited research on marine actinobacteria from A & N Islands Isolationofmarineactinobacteria has been reported. To our knowledge, no studies have Isolation and enumeration of actinobacteria was per- been reported on the characterization of marine acti- formed as described previously by Ellaiah et al. [15] nobacteria from Port Blair Bay of A & N Islands. Rather, using starch casein agar (SCA) medium containing sol- these Islands are an unexploited part of Indian seas and uble starch 10 g, vitamin free casein 0.3 g, KNO 2 g, 3 have rarely been explored for microbial diversity NaCl 2 g, K HPO 2 g, MgSO .7H O 0.05 g, CaCO 2 4 4 2 3 Meenaetal.BMCMicrobiology2013,13:145 Page3of17 http://www.biomedcentral.com/1471-2180/13/145 Figure1Mapshowingthestudyarea,MinnieBay,A&NIslands,India. 0.02 g, FeSO .7H O 0.01 g and agar 20 g, pH 7.0±0.2 growers, the isolates those revealed good growth bet- 4 2 [16], with 50% aged sea water. Medium was added with ween 4th to 7th day of incubation were considered as mo- nalidixic acid 25μg/ml (HiMedia,Mumbai, India) toin- derate growers and the isolates those raised after 7 days hibit the fast growing Gram negative bacteria. Soil sam- was considered as slow growers [13]. Mycelial colour was ples were mixed and then serially diluted in sterile sea also monitored and documented along with the growth water and spread plated on SCA plates. The plates were parameters. incubatedatroomtemperature(28±2°C)for21days. Appearance and growth of marine actinobacteria were Characterizationandidentificationofactinobacteria monitored regularly. The colonies were recognized by Morphological, biochemical, culture and physiological their characteristic chalky to leathery appearance on characterization of the actinobacterial isolates of Minnie SCAplates. Colonieswere purified usingSCAand Inter- Bay were performed as recommended by the Interna- national Streptomyces Project medium 2 (ISP2 medium) tional Streptomyces Project (ISP) which were described and sub cultured in SCA slants for further studies. Pure by Shirling and Gottileb [18]. Microscopic study was cultures were also preserved in 20% glycerol vials and performed with cover slip culture and cellophane me- stored at −80°Cfor long termpreservation[17]. thod [19]. Formation of aerial, substrate mycelium and spore arrangements on mycelium were monitored under Growthcharacteristicsofmarineactinobacteria a phase contrast microscope (Nikon ECLIPSE E600, Actinobacterial isolates were streaked on SCA plates, USA) at 100× magnification. Culture characteristics incubated at room temperature, and the growth rate was such as growth, coloration of aerial and substrate myce- monitored daily up to 21 days. Isolates which exhibited lia, formation of soluble pigment were investigated in good growth within 4 days were considered as fast eight different media including SCA, nutrient agar, yeast Meenaetal.BMCMicrobiology2013,13:145 Page4of17 http://www.biomedcentral.com/1471-2180/13/145 malt agar (ISP-2), oat meal agar (ISP-3), inorganic salt knownquantityof50μg/wellwasloadedinMullerHinton agar (ISP-4), glycerol-asparagine agar (ISP-5), peptone agar plates seeded with test organisms. Negative controls yeast extract agar (ISP-6) and tyrosine agar (ISP-7) with withsolventswerealsomaintained.Afterovernightincuba- the procedures as recommended by ISP. Biochemical tion at 37°C, the zone of inhibition was documented in characterization, namely, Gram’s reaction, MR-VP, H S millimeter. To authenticate the antibacterial property of 2 production, nitrate reduction, oxidase, catalase, urease, crude extracts, screening assay was carried out in starch, casein and gelatin hydrolysis, blood hemolysis, triplicates. TSI, citrate utilization, esculin and hippurate hydrolysis was also performed as suggested by ISP. Physiological characterization such as, effect of pH (5–11), growth Screeningofmarineactinobacteriaforsurfactant range in NaCl (5-30%) and survival at 50°C was also production evaluated.Capabilityoftheisolatestoutilize variouscar- Hemolyticactivity Screening of isolates for hemolytic activity were per- bon sources was performed in ISP-2 agar medium with formed in blood agar medium containing 5% (w/v) pep- phenol red as indicator [20]. Carbon sources viz., fruc- tone, 3% (w/v) yeast extract, 5% (w/v) NaCl and 5% (v/v) tose, lactose, starch, dextrose, rhamnose, mannitol, mal- human blood [24]. Plates were examined for hemolysis tose, adonitol, arabinose and raffinose were used in this after incubation at 37°C for 5 days. Presence of clear study. Identification of the isolates was made with refer- ence to Bergey’s manual of Systematic Bacteriology [21] zone around colonies signifies the potential of isolates forsurfactantproduction. andWaksman[22]. Screeningofmarineactinobacteriaforantibacterial Screeningforlipaseproduction potential Aptitude of the isolates to synthesize extracellular lipase Isolates collected from Minnie Bay were screened for was monitored using ISP 2 medium with 1% (w/v) tri- antibacterial activity by cross streak method [23]. The butyrin with pH 7.4. A loopful of inoculum was streaked isolates were cross streaked on SCA medium and incu- on to test agar plates and incubated at 30°C for 7 days. bated at room temperature for 5 days. After observing a After incubation, the plates were examined for potential good ribbon like growth of actinobacterial cultures, lipase producers by recording clear zone around overnight cultures of Proteus mirabilis MTCC1429, colonies. Escherichia coli MTCC443,Vibrio cholerae MTCC3904, Klebsiella pneumoniae MTCC109, Streptococcus pneu- moniae MTCC1935, Enterococcus faecalis MTCC439, Productionmedium Pseudomonas aeruginosa MTCC424, Bacillus subtilis Potential isolates (Streptomyces sp. NIOT-VKKMA02, MTCC441, Staphylococcus aureus MTCC96, Shigella Streptomyces sp. NIOT-VKKMA26 and Saccharopolyspora flexineri MTCC1457, Micrococcus luteus MTCC1541 sp. NIOT-VKKMA22) for surfactant biosynthesis was fur- and Salmonella typhi MTCC734 were streaked at the ther cultivated in production medium with 5% (w/v) pep- right angle ofactionobacterial cultures. Plateswere again tone, 1% (w/v) yeast extract, 10% (w/v) glucose, 1% (w/v) incubated at 28°C for 48 hrs and the zone of inhibition NaCl, 0.5% (w/v) K HPO , 0.1% (w/v) FeSO , 0.2% (w/v) 2 4 4 was documented. SCA plates without actinobacteria, but Na CO and 0.1% (w/v) MgSO , with pH 7 and incubated 2 3 4 with simultaneous streaking of test organisms were at28°Cfor7daysonashakerincubatorat200rpm. maintainedascontrol. Extractionofantibacterialcompounds Dropcollapsingtest Selected antagonistic actinobacterial isolates (Streptomyces Quantitative drop-collapse test to confirm surfactant sp. NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 production by potential isolates was performed as and Saccharopolyspora sp. NIOT-VKKMA22) were inocu- described by Youssef et al. [25]. Briefly, 0.02% (v/v) latedintostarchcaseinbroth,andincubatedonashakerat mineral oil was stacked on to 96 well microtitre 28°C for 7 days. After incubation, culture broths were fil- plates and equilibrated for 1 h at 37°C. Subsequently, tered through Whatman No.1 filter paper to separate cell 5 μl of culture supernatant was added to the surface mass from the medium. The cell filtrate was mixed separ- of oil and the shape of supernatant on oil surface ately in ethyl acetate, ethyl alcohol, methanol and concen- was observed after 1 min. Culture supernatant that trated under pressure in a Buchi Rotavapor R-205 (Buchi makes oil to collapse was documented as positive Labortechnik AG, Switzerland) at 30°C. Further, the crude and supernatant remains beaded were scored as solvent extracts were screened for antibacterial activity negative, which are scrutinized with distilled water against 12 clinical pathogens by well diffusion assay. A as control. Meenaetal.BMCMicrobiology2013,13:145 Page5of17 http://www.biomedcentral.com/1471-2180/13/145 Oildisplacementtest by the amount of glucose equivalents released in me- Oil displacement assay was performed based on the dium. Briefly, 10 ml reaction mixture consisting of methodology of Morikawa et al. [26]. Weathered crude 0.5 ml cell free supernatant (CFS), 0.5 ml of 1% soluble oil 0.015% (v/v) was laid on 40 μl of Milli Q water in a starch dissolved in 0.1 M phosphate buffer (pH 7), re- sterile Petri plate. Subsequently, 10 μl of culture super- maining sterilized distilled water and incubated at 37°C natantwasgentlyaddedonthesurfaceofoilfilm.Diam- for 15 min [29]. Reaction was stopped by adding 3, 5- eter and area of clear halo visualized under visible light dinitrosalicylicacid[30],andbyboiling for 10min. Con- were measured after1min. centration of released glucose was measured at 620 nm and the quantity was determined with glucose standard Emulsificationassay curve. One unit (U) of amylase activity was defined as Emulsification activity was determined by the method- the μg quantity of glucose equivalents liberated per min ology reported byParaszkiewiczet al. [27].Kerosene and perml ofenzymeundercontrolledconditions. cell free supernatant was mixed in the final concentra- tion of 1:1, vortexed vigorously for 2 min and incubated Cellulaseactivity at room temperature for 24 h. Height of the emulsified Cellulase activity was performed by shake flask method, layer and emulsification index was estimated as E = with the medium composition of 0.5% (w/v) CMC, 0.2% 24 H /H ×100, where E is the emulsification activity (w/v) yeast extract, 0.5% (w/v) peptone, 0.05% (w/v) EL S 24 after 24 h, H the height of emulsified layer, and H is MgSO , 0.05% (w/v) KH PO , 0.15% NaCl and 0.05% EL S 4 2 4 the height of total liquid column. The assay was per- CaCl with pH 7. Prospective actinobacterial isolates 2 formed in triplicate and compared with distilled water as (Streptomyces sp. NIOT-VKKMA02, Streptomyces sp. control. NIOT-VKKMA26 and Saccharopolyspora sp. NIOT- VKKMA22) were inoculated into production medium Screeningofmarineactinobacteriaforextracellular and incubated in shaker incubator at 28°C for 7 days. enzymes After incubation, culture broth was filtered through Primaryenzymaticscreening Whatman No.1 filter paper and cell free supernatant Screening of isolates were performed to determine its was obtained by centrifugation at 10,000 rpm for capability to yield industrially important enzymes such 10 min. Cellulase activity wasdetermined by the amount as lipase, amylase, protease, gelatinase, cellulase, DNase, of glucose equivalents released in medium. 10 ml reac- urease and phosphatase with the methods adopted pre- tion mixture consisting of 0.5 ml CFS, 0.5 ml of 0.5% viously by Leon et al. [28]. Isolates were streaked on test CMC dissolved in 0.1 M phosphate buffer (pH 7), agar medium with respective substrates such as starch, remaining sterilized distilled water and incubated at carboxymethyl cellulose (CMC), gelatin, tributyrin, ca- 37°C for 15 min [29]. Reaction was stopped by adding 3, sein, 40% urea, 0.2% DNA and phenolphthalein phos- 5-dinitrosalicylic acid [30], and by boiling for 10 min. phate agar plates separately and incubated at room Concentration of released glucose was measured at temperature for 5 days. After incubation, plates were 620 nm and the quantity was determined with glucose flooded with respective indicator solution and the devel- standard curve. One unit (U) of cellulase activity was opment of clear zone around the growth of organism defined as μg quantity of glucose equivalents liberated wasdocumentedaspositive resultsfor enzymeactivity. per min per ml of enzyme under prescribed conditions. Secondaryenzymaticscreening Amylaseactivity Proteaseactivity Studies on amylase production with the potential iso- Potential of the isolates to synthesize protease was per- lates (Streptomyces sp. NIOT-VKKMA02, Streptomyces formed by shake flask method, with medium compos- sp. NIOT-VKKMA26 and Saccharopolyspora sp. NIOT- ition of 0.2% (w/v) soluble starch, 0.05% (w/v) peptone, VKKMA22) were performed by shake flask method. The 0.05% (w/v) glucose, 0.05% (w/v) yeast extract, 0.05% productionmediumconsistedof1%(w/v)soluble starch, (w/v) casein, 0.02% (w/v) soyabean meal, 0.06% (w/v) 0.2% (w/v) yeast extract, 0.5% (w/v) peptone, 0.05% (NH4) SO , 0.08% (w/v) CaCO and 0.05% NaCl with 2 4 3 (w/v) MgSO , 0.05% (w/v) KH PO , 0.15% NaCl and pH 7. Prospective actinobacterial isolates (Streptomyces 4 2 4 0.05% CaCl with pH 7. Isolates were inoculated into sp. NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 2 production medium and incubated in shaker incubator andSaccharopolysporasp.NIOT-VKKMA22)wereinocu- at 28°C for 7 days. After incubation, culture broth was latedintoproductionmediumandincubatedinshakerin- filtered through Whatman No.1 filter paper and cell free cubatorat28°Cfor7days.Afterincubation,culturebroth supernatant was obtained by centrifugation at was filtered through Whatman No.1 filter paper and 10,000 rpm for 10 min. Amylase activity was determined cell free supernatant was obtained by centrifugation Meenaetal.BMCMicrobiology2013,13:145 Page6of17 http://www.biomedcentral.com/1471-2180/13/145 at 10,000 rpm for 10 min. Protease activity was deter- marker (MBI Fermentas). Positive amplicons as judged mined by incubating the reaction mixture containing by size were purified using QIAquick PCR purification 0.1 ml CFS and 0.9 ml of 2% casein in 0.1 M NaOH- kit (Qiagen, Germany) and sequenced on an ABI PRISM KH PO buffer (pH 7) at 37°C for 30 min. Reaction 377genetic analyzer (AppliedBiosystems,USA). 2 4 was stopped by addition of 1.5 ml of 1 M trichloroacetic acid. After 15 min, the mixture was centrifuged at Phylogenicanalysis 10,000 rpm for 10 min and the protein concentration in 16SrRNAsequencesofthepotentialstrains(Streptomyces supernatant was determined according to the method of sp. NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 Lowry et al. [31]. One unit (U) of protease activity is andSaccharopolysporasp.NIOT-VKKMA22)wasaligned equivalent to μg of tyrosine liberated per ml of enzyme manually in GenBank database with BLAST [33] and the underprescribedconditions. sequences with 100-98% homology were considered for molecular taxonomy analysis. Multiple alignment of 16S Molecularidentificationofpotentialstrains rRNA sequences in this study and sequences in GenBank DNAisolation database was performed with CLUSTAL X program [34]. Genomic DNA of Streptomyces sp. NIOT-VKKMA02, Phylogenetic trees were constructed by neighbor-joining Streptomyces sp. NIOT-VKKMA26 and Saccharopolyspora and maximum-parsimony tree making methods in Mo- sp. NIOT-VKKMA22 was isolated by following the modi- lecularEvolutionaryGeneticAnalysis(MEGAversion5.0) fiedprocedureofKutchmaetal.[32].Briefly,2mlof72hrs [35]andbootstrapvaluesbasedon1,000replication[36]. culturebrothwascentrifugedat8,000rpmfor5minutesat room temperature and the pellets were washed with 1 ml Results TEbuffer,suspendedinTEbuffercontaininglysozymewith Physico-chemicalparameters thefinalconcentrationof4mg/ml. Themixturewasincu- The details of sampling site and various physico- bated at 37°C water bath for 3 hrs. Subsequently, 75 μl of chemical properties of water samples collected from the 10%SDSand125μlof5MNaClwereaddedtocellpellet site are provided in Table 1. In sampling site, DO value andincubatedat37°Cfor30min.Reactiontubeswerelater was observed to be 6.24 mg/l in both surface and bot- incubated at −40°C for 5 min and subsequently to 65°C tom waters. Moreover, total nitrogen level was also water bath for 3 min. This step was repeated 3 times and found to a significant level (12.4 and 15.2 μmol/l) in sur- the supernatant was collected by centrifugation at face and bottom waters, respectively. Sampling location 8,000 rpm for 10 min at room temperature. To the super- wassloppy,muddyandwasnoticedwithawidediversity natant, 50 μg/ml Proteinase K and 200 μg/ml RNase were ofmarinelife including flora,fauna andmicrobes. added and incubated at 37°C for 30 min. Equal volume of phenol:chloroform:isoamylalcohol(25:24:1)wasaddedto Characterizationofisolates thesolutionandmixedbyinversion.Aftercentrifugationat Sediment samples were collected during low tide and a 8,000 rpm for 5 min, upper aqueous phase containing total of 26 actinobacteria were isolated using SCA DNA was recovered and precipitated with two volumes of medium with nalidixic acid prepared in aged seawater. 95% ethanol by centrifugation at 13,000 rpm for 15 min. All isolates were identified at generic level based on the DNA pellet was dissolved in 50 μl of TE buffer and stored colony, microscopic observations and biochemical char- at−40°Cforfurtheruse. acteristics. Morphological and cultural characteristics re- vealed that, maximum of (65.39%) isolates fit in to PCRamplificationof16SrRNA greenish, blue and grey colour series. Of 26 isolates, Amplification of 16S rRNA was performed using uni- 34.60% (n=9) isolates were allocated to the genus Sac- versal primers 16Sf (5′ AGAGTTTGATCCTGGCTCAG charopolyspora, 19.23% (n=5) isolates were assigned as 3′) and 16Sr (5′ GGTTACCTTGTTACGACTT 3′). genus Streptomyces and remaining isolates as Streptover- Final volume of reaction was 25 μl, which comprised ticillium (n=4), Actinopolyspora (n=2), Nocardiopsis Taq buffer (1×), dNTP’s (200 μM) (MBI Fermentas, (n=2), Microtetraspora (n=2), Actinokineospora (n=1) USA), forward and reverse primer (0.5 μM), MgCl and Dactylosprangium (n=1). Percentage frequency of 2 (1.0 mM), Taq DNA polymerase (1.25 U; MBI isolates is shown in (Figure 2). Present study revealed Fermentas), template (1 μl) and remaining autoclaved that; of the total isolates, Saccharopolyspora and Strepto- Milli Q water. PCR was performed with the initial de- myces were found to be the dominant genera belongs to naturationat98°Cfor3min,followed by30cyclesofre- the class Actinobacteria and order Actinomycetales. In action with denaturation at 94°C for 1 min; annealing at this study, majority of the isolates determined aerial 53°C for 1 min; extension at 72°C and final extension at coiled mycelia and spores arranged in chains. Among 26 72°C for 10 min. PCR amplified products were analyzed isolates, 8 genera were identified and each genus was on 1.5% agarose gel along with DNA molecular weight distinguished by their spore, mycelia and aerial hyphae. Meenaetal.BMCMicrobiology2013,13:145 Page7of17 http://www.biomedcentral.com/1471-2180/13/145 Table1Physico-chemicalparametersofstudyarea(MinnieBay) Parameters Description Description Units Studyarea MinnieBay MinnieBay Latitude(N) 11°38’42.8”N 11°38’42.8”N DDMMSS Longitude(E) 92°42’30.7”E 92°42’30.7”E DDMMSS Year 2011 2011 YYYY Month May May Mon Zone Nearshore Nearshore Source Surface Bottom Tide LowTide LowTide Atmospherictemperature 31.10 °C WaterQuality Watertemperature 31.0 30.4 °C pH 8.16 8.14 Salinity 31.64 31.73 PSU CO2- 15.60 10.8 (mg/l) 3 HCO- 21.96 35.38 (mg/l) 3 DissolvedOxygen 6.24 6.24 (mg/l) BiochemicalOxygenDemand 2.90 2.81 (mg/l) Suspendedsolidconcentration 40.56 75.65 (mg/l) Nitrite 0.04 0.16 (μmol/l) Nitrate 0.75 0.72 (μmol/l) Ammonia 0.12 0.42 (μmol/l) TotalNitrogen 12.4 15.2 (μmol/l) InorganicPhosphate 0.18 0.18 (μmol/l) TotalPhosphorous 0.56 0.65 (μmol/l) Silicate 4.89 4.55 (μmol/l) Figure2Percentagefrequencyofisolatedactinobacteriagenera. Meenaetal.BMCMicrobiology2013,13:145 Page8of17 http://www.biomedcentral.com/1471-2180/13/145 Isolates were screened for their optimum growth on lipase enzyme production. Isolates Streptomyces sp. SCA medium, of 26 isolates; 13 isolates (50%) revealed NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 fast growth, 9 isolates (34.6%) exhibited moderate growth and Saccharopolyspora sp. NIOT-VKKMA22 illustrated andminimumof4isolates(15%)weredeterminedasslow the maximum comprehensible zones with 25 mm, growers (Figure 3). Morphological, physiological, bioche- 17 mm and 13 mm, respectively. Moreover, the same mical, cultural characteristics and utilization of carbon proportion of isolates determined positive results for sources of the isolates are given in Tables 2 and 3. Of 26 drop collapsing and oil displacement assays by forming actinobacterial isolates, 12 isolates produced melanin, 23 flat drop and increasing the surface area, respectively. isolates displayed distinctive reverse side pigment and 6 These results confirmed the capability of isolates to isolatesproduceddiffusiblepigments. synthesize surface active molecules ofenvironmental im- portance. Actinobacterial strain Streptomyces sp. NIOT- Antibacterialpotentialofisolates VKKMA02 revealed best result for oil replacement area Isolates were analyzed against 12 clinical pathogens and with 36.29 cm2. Emulsification activity (E ) of the sur- 24 the extent of antibacterial activity was varied among the factant from Streptomyces sp. NIOT-VKKMA02 was actinobacterial isolates (Figure 4). Of 26 isolates, 96% measured with kerosene and CFS, E ranged from 1.8- 24 exhibited appreciable inhibitory activity against Gram 63.6%. Emulsification activity of the potential isolate was negative bacteria and 73% acted against Gram positive perceived from first day of incubation and demonstrated bacteria. Remaining 23% revealed excellent antibacterial highest emulsificationactivity on7thday. activity against both Gram positive and Gram negative bacteria. However, strain Streptomyces sp. NIOT- Growthcharacteristicsoftheisolates VKKMA02 was found to have broad spectral antibacter- Isolates were screened for their growth at various pH ial activity and was further investigated by 3 different and NaCl levels. Unexpectedly, all isolates exhibited solventextracts.Ofwhich,ethyl acetate extract disclosed excellent growth in the pH range of 6–11 and 69.23% maximum inhibitory activity against all pathogens tested isolates displayed good growth at acidic pH (pH-5). than methanol and ethanol extracts. Antibacterial effi- However, of 26 isolates, 61.5% isolates recorded good cacy of ethyl acetate extract from Streptomyces sp. growth in 25% NaCl and 18% displayed excellent growth NIOT-VKKMA02 against clinical pathogens is depicted in 30% NaCl. With reference to the growth studies, it inTable4. was established that, all isolates in this study were halo- philicandalkalitolerant. Potentialofisolatesinsurfactantproduction Actinobacterial isolates were studied for their ability to Screeningofextracellularenzymes synthesize surface active molecules. Isolates were pro- No studies on characterization of extracellular enzyme cessed with series of tests viz., streaking in blood agar, production from marine actinobacteria of A & N Islands lipolytic activity, drop collapsing test, oil displacement have been reported. Of 26 isolates, 22 isolates were assay and emulsification activity. Of 26 isolates, max- found to synthesize gelatinase and urease, 21 isolates imumof20(77%)revealedpositiveresultsforhemolycin demonstrated amylolytic activity, 20 isolates exhibited production by forming clear zone around the colonies in proteolytic and lipolytic activity and 18 isolates displayed bloodagarmedium.Inlipolyticassay,clearzonewasob- cellulolytic activity. Interestingly, 16 isolates exhibited served around the colonies on tributyrin agar plates by excellent DNase activity and 8 isolates revealed positive for alkaline phosphatase (Figure 5). To our recognition, 13 isolates exhibited constructive results in the produc- tion of 8 extracellular enzymes of industrial importance. Streptomyces sp. NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 and Saccharopolyspora sp. NIOT- VKKMA22exhibited elevated enzymaticactivity for all8 industrial enzymes. Consequently, these potent isolates were subjected for the detailed characterization on in- dustrially potent enzymes like amylase, cellulase and protease. Production of enzymes by the potent isolates was achieved by submerged fermentation and their enzymatic activities are shown in Table 5. As specified in the table, isolate Streptomyces sp. NIOT-VKKMA02 Figure3GrowthrateofactinobacteriaisolatedfromA& proved maximum amylolytic activity (R/r=4.3), proteo- NIslands. lytic activity (R/r=3.1) and cellulolytic activity (R/r= Meenaetal.BMCMicrobiology2013,13:145 Page9of17 http://www.biomedcentral.com/1471-2180/13/145 Table2PhenotypiccharacteristicsofselectedactinobacteriafromA&NIslands Properties Streptomycessp. Streptomycessp. Saccharopolysporasp. Streptoverticilliumsp. NIOT-VKKMA246 NIOT-VKKMA326 NIOT-VKKMA1713,4522 NIOT-VKKMA16,234 Morphologicalcharacteristics Sporemorphology Chain Spiral Hook Chain Colourofaerialmycelium Green Darkgrey Blue Greenishgrey Colourofsubstratemycelium Grey Brown Brown Grey Solublepigment Greenishbrown Brown - - Sporemass Green Darkgrey Blue Green Biochemicalcharacteristics Gramstaining + + + + Indoleproduction - - - - MethylRed + - - + VogesProskauer - - - - Citrateutilization + + + + HSproduction - + + - 2 Nitratereduction + + + + Urease + + + + Catalase - + + - Oxidase + - - + Melaninproduction - + + - Starchhydrolysis + + + - Haemolysis + + + + Triplesugariron alk/alk alk/alk alk/alk alk/alk Survivalat50°C Moderate Good Good Moderate Carbonsourceutilization Starch + + + - Dextrose - + + - Fructose + + + + Maltose + + + + Mannitol + + + + pH 5 + - - + 6 + + + + 7 + + + + 8 + + + + 9 + + + + 10 + + + + 11 + + + + NaCltolerence(%) 5 + + + + 10 + + + + 15 + + + + 20 + + + + 25 + + + + 30 + - - + Meenaetal.BMCMicrobiology2013,13:145 Page10of17 http://www.biomedcentral.com/1471-2180/13/145 Table3PhenotypiccharacteristicsofselectedactinobacteriafromA&NIslands Properties Actinopolyspora Nocardiopsis Microtetraspora Dactylospoangium NIOT-VKKMA818 NIOT-VKKMA525 NIOT-VKKMA1719 NIOT-VKKMA21 Morphologicalcharacteristics Sporemorphology Longelongated Coccoid Short Fingershaped Colourofaerialmycelium Paleyellow Dullbrown Creamywhite Greenishblack Colourofsubstratemycelium Brown Brown Brown - Solublepigment Greenishbrown Brown - - Sporemass Paleyellow Dullbrown Creamywhite Greenishblack Biochemicalcharacteristics Gramstaining + + + + Indoleproduction - - + - MethylRed + + - - VogesProskauer + - - - Citrateutilization + - + - HSproduction + + - + 2 Nitratereduction + - - + Urease - + + + Catalase + + + + Oxidase + + + + Melaninproduction + + + - Starchhydrolysis + + + - Haemolysis + + + - Triplesugariron - alk/alk alk/alk - Survivalat50°C Excellent Excellent - - Carbonsourceutilization Starch + + + - Dextrose + + + + Fructose - + + - Maltose + + - + Mannitol - + - + pH 5 - - - + 6 + + + + 7 + + + + 8 + + + + 9 + + + + 10 + + + + 11 + + + + NaCltolerence(%) 5 + + + + 10 + + + + 15 + + + + 20 + + + + 25 - + - + 30 - + - +