6 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote Notes on the taxonomy of Actinote intensa Jordan (Lepidoptera: Nymphalidae: Heliconiinae) and the description of a new sibling species from eastern Ecuador Keith R. Willmott1, Gerardo Lamas2, and Jason P. W. Hall3 1. McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, Gainesville, Florida, USA; [email protected] 2. Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; [email protected] 3. Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington, DC 20560-0127, USA Abstract: We review the taxonomy of Actinote intensa Jordan stat. rest. and describe a new sibling species, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., from the east Andean slopes of central and southern Ecuador. The species are broadly sympatric, occur in the same sites throughout the more restricted range of the new species, and differ in a number of wing pattern characters, supported by a mean 2% pairwise divergence in their COI DNA barcodes. Resumen: Revisamos la taxonomía de la especie Actinote intensa Jordan stat. rest. y describimos una nueva especie relacionada, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., de las vertientes orientales de los Andes en el centro y sur del Ecuador. Las especies son simpátridas y ocurren en los mismos sitios en el rango más restringido de la especie nueva, y tienen una variedad de caracteres diferentes en el patrón del ala, apoyados por una divergencia promedio de 2% en sus codigos de barra del gen COI. Key words: Acraeini, Andes, cloud forest, cryptic species, DNA barcoding, Peru, wing pattern INTRODUCTION a number of species are very restricted in distribution and poorly represented in collections, and Lamas (2004) listed two Although not nearly as diverse as their Old World relatives, undescribed species under those generic names from Peru. the Neotropical Acraeini contains more than fifty species and Otherwise, no new species outside of Actinote s. s. have been the group has been the subject of a number of recent taxonomic described for more than 50 years, the most recent being Actinote studies. The generic classification of these species is currently rubrocellulata Hayward, 1960 (Lamas, 2004). unresolved, with Pierre (1987) placing all Neotropical species During a long-term survey of the butterflies of Ecuador, within the pantropical genus Acraea Fabricius, 1807, and we noticed that series from single sites of the species formerly the most recent classification (Lamas, 2004) dividing the known as “Actinote radiata” (e.g., Jordan, 1913; D’Abrera, same species among three genera, Actinote Hübner, [1819], 1987; Lamas, 2004) often apparently contained two distinct Altinote Potts, 1943, and Abananote Potts, 1943. Potts (1943), phenotypes. However, substantial wing pattern variation within partly following Jordan (1913), used characters of the scale each of those phenotypes complicated the identification of morphology on the ventral wing surfaces to separate Actinote diagnostic characters and the correct application of described and Altinote, placing Abananote as a subgenus of the latter. The names. Here, we use DNA “barcodes” to clarify species limits, monophyly of these taxa remained untested, however, until investigate possible relationships with allopatric taxa, review Silva-Brandão et al. (2008) showed that although Actinote as the identity of existing names, and describe a new sibling conceived by Lamas (2004) represented a single clade, neither species that is widespread and locally common from central to Altinote nor Abananote was monophyletic. Silva-Brandão et al. southeastern Ecuador. (2008: 528) therefore suggested that “Actinote Hübner, [1819] should be expanded to include all Neotropical Acraeini”, and MATERIALS AND METHODS we follow that suggestion here, referring to Actinote in the sense of Lamas (2004) as Actinote sensu stricto (s. s.). Field work was conducted by the authors and colleagues Actinote has also been the subject of a notable number of throughout Ecuador and Peru over many years to collect new species descriptions in recent years (e.g., Penz & Francini, material for taxonomic study and document distribution and 1996; Francini et al., 2004; Paluch et al., 2006; Neild, 2008; behavior. Material was studied in numerous public and private Willmott et al., 2009). All of those species have been within collections in the Americas and Europe to examine type Actinote s. s., which reaches its highest diversity in southeastern specimens, study variation and record distribution data. The Brazil and the periphery of the Amazon basin (Silva-Brandão following collection acronyms are used: FLMNH: McGuire et al., 2008). In Andean cloud forest habitats, however, the Center for Lepidoptera and Biodiversity, Florida Museum of dominant species are those that were placed by Lamas (2004) Natural History, University of Florida, Gainesville, USA; JEPE: in the genera Abananote and Altinote. Within those groups Jean-Claude Petit collection, Ducy, France; KWJH: Keith R. WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 7 Willmott & Jason P. W. Hall collection, Gainesville, FL, USA; RESULTS AND DISCUSSION INABIO: Instituto Nacional de Biodiversidad, Quito, Ecuador; MZUJ: Muzeum Zoologiczne Uniwersytetu Jagielloñskiego, DNA barcodes Kraków, Poland; NHMUK: Natural History Museum, London, The neighbor-joining analysis of the DNA barcode UK; PIBO: Pierre Boyer collection, Le Puy, France. sequences showed a single clade containing specimens with Morphology was studied using standard techniques, with the “A. radiata” wing pattern, which was split into two distinct adult abdomens being soaked in hot 10% KOH for 10-15 clades corresponding to the two phenotypes initially recognized minutes, dissected and subsequently stored in glycerine. Body within series of sympatric specimens (Fig. 1). Examination morphology and dissections were studied using a binocular of specimens within each clade allowed the identification of microscope at up to 100x magnification. The terminology for diagnostic wing pattern differences (see Table 1) that enabled male genitalic and abdominal structures follows Scoble (1992), us to associate relevant type specimens with one of the clades, and nomenclature for venation follows Comstock & Needham A. intensa, while the other clade represents the new species (1918). We use the abbreviations DFW, VFW, DHW and VHW described here, A. johncoulsoni n. sp.. The mean pairwise for dorsal and ventral forewing and hind wing. distance between the two species was 2%, while within-group We extracted genomic DNA from legs removed from mean pairwise distances were 0.5% (A. intensa) and 0.1 % Actinote specimens using Qiagen’s DNeasy Blood & Tissue (A. johncoulsoni n. sp.). Within A. intensa, three Peruvian Kit following the manufacturer’s protocol, incubating specimens (LEP-04012, LEP-04014, LEP-04015) formed a samples overnight (24 h) and using a final elution volume of somewhat isolated clade along with a specimen (LEP-04013) 50-100 ul with the smaller elution for older specimens. We putatively from Tungurahua province in Ecuador. The latter amplified the first half of the mitochondrial gene cytochrome specimen has a similar wing pattern to the Peruvian specimens oxidase I (COI), also known as the barcode region for (different from other Tungurahua A. intensa) and comes from the animals (Hebert et al., 2003), using primer pairs LCO same collection, so we assume that it represents a labeling error. (forward, GGTCAACAAATCATAAAGATATTGG) and The clade containing Actinote intensa and A. johncoulsoni was HCO (reverse, TAAACTTCAGGGTGACCAAAAAATCA) relatively distant from the nearest other included sequences. (Folmer et al., 1994), or LCO_nym (forward, TTTCTACAAATCATAAAGATATTGG) and HCO_nym Actinote intensa Jordan, 1910, stat. rest. (reverse, TAAACTTCAGGATGACCAAAAA) (Neild et al., (Figs. 2A-I, 3A, 4, 5D,E) 2015), or LepF1 (forward, ATTCAACCAATCATAAAGATAT) and LepR1 (reverse, AAACTTCTGGATGTCCAAAAA) Actinote radiata intensa Jordan (1910: 463). Type locality: Peru, [Pasco], Cushi, 1800-1900 m. Types: Lectotype ♂: “LECTOTYPE ♂ Actinote (Hebert et al., 2004). For recalcitrant samples we amplified the radiata intensa Jordan G. Lamas. det. 1987//Cushi, Prov. Huanuco, gene region in two fragments, using primer pairs LCO_nym Peru, 1900 m (W. Hoffmanns).//A. radiata intensa Type. Jord. Nov. Zool. and K699 (reverse, WGGGGGGTAAACTGTTCATCC), and 1910.//LECTOTYPE//Type”; Paralectotypes (6 ♂): 3 ♂, same collection Ron (forward, GGATCACCTGATATAGCATTCCC) and data as lectotype; 3 ♂, same collection data as lectotype except 1820 m, 1904; (NHMUK) (all examined). Nancy (reverse, CCTGGTAAAATTAAAATATAAACTTC) =Acraea radiata Hewitson (1868: [32], pl. [18], figs. 39-41), junior primary (Monteiro & Pierce, 2001; Elias et al., 2007). All PCR reactions homonym of Acraea zitja var. radiata Guenée, 1865. Type locality: were conducted in a 20 ul volume comprising 2 ul DNA, 0.4 ul Ecuador. Types: Lectotype ♂: “LECTOTYPE ♂ Acraea radiata of each primer (10 uM), 0.5 ul of Bovine Serum Albumin (BSA, Hewitson G. Lamas. det. 1987//Ecuador Hewitson Coll. 79.-69. Acraea radiata, Hew. 3//B. M. Type No. Rh 7721 Acraea radiata, ♂ Hew.// 20 mg/mL) (for older samples), MgCl catalyst and Taq DNA 2 LECTOTYPE//Type H. T.”; Paralectotype ♀: “PARALECTOTYPE ♀ polymerase. Typical reaction conditions were as follows: 1 min Acraea radiata Hewitson G. Lamas. det. 1987//Ecuador Hewitson Coll. at 94°C followed by 5 cycles of 30 s at 94°C, 40 s at 45°C, 1 79.-69. Acraea radiata, Hew. 4//B. M. Type No. Rh 7722 Acraea radiata, ♀ min at 68-72°C (depending on the Taq mix), followed by 35 Hew.//Paralectotype//Type H. T.//BMNH(E) #808382”; Paralectotypes (2 ♂): 1 ♂: “Ecuador Hewitson Coll. 79.-69. Acraea radiata, Hew. 2” cycles of 30 s at 94°C, 40 s at 51°C, 1 min at 68-72°C, followed [=A. johncoulsoni n. sp.]; 1 ♂: “Ecuador Hewitson Coll. 79.-69. Acraea by 5 min at 68-72°C. Single strands of the PCR products were radiata, Hew. 1” [=A. johncoulsoni n. sp.]; (NHMUK) (all examined). sequenced by University of Florida’s Interdisciplinary Center =Acraea (Abananote) intensa gerardolamas Kemal & Koçak (2007: 2), for Biotechnology Research Sanger Sequencing Group using replacement name, n. syn. Type locality and Types as for Acraea radiata above. the same primers as in the PCR. Where necessary, fragments were assembled into composite Actinote radiata radiata Hewitson: Jordan (1913); D’Abrera (1987: sequences and all 43 new sequences were aligned using BioEdit 436 – figured specimen is A. johncoulsoni) v. 7.1.3 (Hall, 1999), with 17 additional sequences obtained Actinote radiata intensa Jordan: Jordan (1913); D’Abrera (1987) Abananote radiata radiata (Hewitson): Lamas ([1997]); Lamas (2004) from GenBank (Appendix 1). The final aligned sequences Abananote radiata intensa (Jordan): Lamas ([1997]); Lamas (2004) were of length 666 bp. To test for consistent genetic differences Acraea (Abananote) intensa Jordan: Kemal & Koçak (2007) between phenotypes we conducted a neighbor-joining analysis Acraea (Abananote) intensa intensa Jordan: Kemal & Koçak (2007) using MEGA 7.0 (Kumar et al., 2016), with the Kimura 2-parameter substitution model, partial deletion of sites with Diagnosis: Identification of this species with respect to A. missing data, and other default settings. The same settings were johncoulsoni n. sp. is discussed under the latter species. Actinote used to compute mean pairwise distances between sequences, intensa and A. johncoulsoni are otherwise easily identified from between and within groups. New sequences are deposited in other species in the genus by the long, black hair-like scales GenBank. present on the VHW in the basal half of cell Cu1-M3 (shared 8 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote KW-071009-79 johncoulsoni LEP-06920-johncoulsoni LEP-00016-johncoulsoni LEP-37582-johncoulsoni, Fig. 2N . p LEP-37577-johncoulsoni, Fig. 2O s LEP-37576-johncoulsoni . n LEP-37574-johncoulsoni ni LEP-37571-johncoulsoni o s LEP-37570-johncoulsoni HOLOTYPE johncoulsoni, Fig. 2J,K ul LEP-37569-johncoulsoni o c LEP-37567-johncoulsoni, Fig. 2L n h LEP-37566-johncoulsoni o j LEP-37565-johncoulsoni e t LEP-37438-johncoulsoni, Fig. 2M o n LEP-37434-johncoulsoni ti c LEP-04157-johncoulsoni A LEP-04156-johncoulsoni LEP-37575-johncoulsoni LEP-37568-johncoulsoni LEP-37437-johncoulsoni LEP-37572-johncoulsoni LEP-04014-intensa LEP-04015-intensa, Fig. 2E LEP-04013-intensa LEP-04012-intensa EU275517.1 Abananote radiata voucher NW90-12 LEP-37585-intensa LEP-37586-intensa LEP-37583-intensa a s LEP-06921-intensa n e LEP-00018-intensa t n LEP-00017-intensa, Fig. 2H i e LEP-00014-intensa ot LEP-37587-intensa n ti LEP-37584-intensa c A LEP-04016-intensa LEP-04017-intensa LEP-04018-intensa, Fig. 2G LEP-37578-intensa LEP-37579-intensa LEP-37580-intensa LEP-37581-intensa, Fig. 2F EU275554.1 Altinote alcione sodalis voucher ac28 EU275563.1 Altinote neleus voucher ac16 EU275516.1 Abananote erinome erinome voucher ac34 EU275564.1 Altinote rubrocelullata voucher ac76 EU275560.1 Actinote momina voucher RV-03-V240 EU275565.1 Altinote tenebrosa voucher NW90-15 LEP-00020-eresia EU275559.1 Altinote eresia voucher ac87 LEP-04153-hilaris EU275561.1 Actinote negra demonica voucher ac46 EU275573.1 Altinote negra demonica voucher ac45 EU275562.1 Altinote negra euclia voucher ac64 EU275555.1 Altinote dicaeus albofasciata voucher E-51-18 EU275558.1 Altinote dicaeus flavibasis voucher C-17-3 EU275556.1 Altinote dicaeus callianira voucher ac25 EU275557.1 Altinote dicaeus callianira voucher ac58 KM012923.1 Actinote pellenea voucher NW129-23 0.0100 Fig. 1. Neighbor-joining tree (Kimura 2-parameter) for Actinote intensa and relatives based on 666 bp of COI (barcode region). WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 9 with A. erinome (C. Felder & R. Felder, 1861) and A. abana gerardolamas, which applies to Ecuadorian specimens, as a (Hewitson, 1868) and noted by Jordan (1913)), the orange junior subjective synonym (n. syn.). DFW band composed of rays, and by the thin orange scaling lining the edges of the veins on the VHW. The male genitalia Distribution: Actinote intensa occurs along the eastern Andes of A. intensa and A. johncoulsoni most closely resemble that from the Río Pastaza valley (Tungurahua) in Ecuador, to of A. abana, but differ in having a sclerotized band around the central Peru (Junín) (Fig. 4). A single specimen in the MZUJ aedeagus immediately anterior of the attachment of the manica. was supposedly collected along the Tena-Loreto road, Napo province, at 1400 m by H. Greeney. We have seen no other Taxonomy and variation: Hewitson (1868) described Acraea specimens from this rather well-sampled road, the elevation is radiata from an unspecified number of specimens in his unusually low for the species, and the wing pattern resembles collection from Ecuador. He described both sexes, and figured that of Peruvian specimens rather than those from nearby the upperside and underside of presumably the same specimen Tungurahua, so the record requires confirmation. in figs. 39 and 40, and the upperside of another specimen in fig. 41. The lectotype specimen in the NHMUK (Fig. 2C,D) Habitat and ecology: Actinote intensa occurs in intact cloud designated by Lamas ([1997]) matches figs. 39 and 40, while forest habitats, from 1600-2500 m in Ecuador and 1360-3000 the second figured specimen, fig. 41, matches the paralectotype m in Peru (Fig. 5A). Males are locally common along rivers and female in the NHMUK (Fig. 2I). Both of these types have the wide streams, flying from 2-6 m, where they also congregate diagnostic wing pattern characters of A. intensa as defined here to feed at damp gravel and rock faces (Fig. 5D,E), particularly (see under Diagnosis for A. johncoulsoni n. sp.). However, an wherever there is urine or rotting carrion. We have also recorded additional two specimens in the NHMUK from Hewitson’s several males in mid-storey and canopy traps baited with rotting collection that are also paralectotypes represent A. johncoulsoni. fish inside forest. We have never seen the female in nature and it Jordan (1910) described a new subspecies, Actinote radiata is very rare in collections. intensa, based on a series of male specimens from Cushi, [Pasco], Peru in the NHMUK. The lectotype was designated by Actinote johncoulsoni Willmott, Lamas & Hall, new species Lamas ([1997]) and is illustrated in Fig. 2A,B. Jordan (1910) (Figs. 2J-O, 3B-H, 4, 5B,C) stated that the dorsal ground color was darker than in Ecuadorian specimens, and that the orange postdiscal streaks were narrower Diagnosis and identification: Actinote johncoulsoni n. sp. can on the DFW and more pinkish on the VFW. Although these be consistently distinguished from its sister species A. intensa features are apparent in the majority of specimens examined, by a number of wing pattern characters. Firstly, the two orange- there is also substantial variation in the width of the orange pink spots in the VFW tornus of A. intensa are approximately DFW band even within Ecuador (Fig. 2F,G,H), and we feel that equal in size, such that an imaginary line connecting their basal the differences are not sufficiently consistent or marked to merit edges is parallel to the wing distal margin (see Fig. 2B,D,F). In subspecific recognition. Within Ecuador there seems to be an A. johncoulsoni, the anterior spot is about twice the width of the approximate cline in the width of the orange DFW band, which posterior, and the aforementioned imaginary line is not parallel is broadest in Tungurahua, moderate in Morona-Santiago, and to the wing margin (see Fig. 2K,L). This is the only wing narrowest in Zamora-Chinchipe provinces. However, we feel pattern character that seems to be stable throughout the range of that there are no easily defined discontinuities in this variation both species. Nevertheless, based on the DNA barcode analysis, that would allow the recognition of subspecies. in localities where the two species are sympatric several other Actinote radiata was widely used as the name for this characters are useful in concert to identify them. These include, species until Kemal & Koçak (2007) noted that it was a junior in particular, the more pinkish VFW postdiscal band and greater primary homonym of Acraea zitja var. radiata Guenée, 1865, basal extension of this band in cell M1-R5 in A. johncoulsoni, and provided the replacement name Acraea (Abananote) while other useful characters are described in Table 1 and intensa gerardolamas. Actinote intensa therefore becomes the illustrated in Fig. 2F,L. No consistent genitalic characters were oldest name for the species (stat. rest.) and we treat the name found to distinguish the species from A. intensa. Table 1. Wing pattern characters differentiating Actinote intensa and A. johncoulsoni n. sp. Only character 7 is consistent in all examined specimens, but the presence of a majority of the other characters helps to confirm identification. Less obvious characters are indicated on Fig. 2F,L. No. Character A. intensa A. johncoulsoni n. sp. 1 Dorsal ground color Brownish black Grayish black 2 DFW postdiscal band color Orange Pinkish orange 3 DHW dark intervenal stripes Hardly visible, instead veins on DHW more Darker intervenal strips more conspicuous conspicuously marked 4 VFW postdiscal band color Orange Pinkish orange 5 VFW postdiscal band extent Not extending to base of cell M1-R5 or notably Extending to base of cell M1-R5 and notably more basally than in adjacent cell M2-M1 more basally than in adjacent cell M2-M1 6 VFW costa Black with scattered orange scales Black with few or no orange scales 7 VFW orange paired tornal Similar in size Anterior spot larger spots 10 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 11 Description: MALE (Fig. 2J,K): Forewing length of holotype 25 mm (21-26 24 Loja-Zamora rd., San Francisco, casa de Arcoiris, [3°59'18''S,79°5'42''W], mm, mean 24.1 mm, n=28). Wing shape and color pattern: very similar to A. 2000-2100 m, (Willmott, K. R., Aldaz, R.), 23 Oct 2006, 1 ♀ [FLMNH- intensa, as illustrated (Fig. 2J,K) and described in comparison with A. intensa MGCL-119807], (FLMNH); km 30 Loja-Zamora rd., 'station electrique', (Table 1). VHW with long, black hair-like scales (‘bristles’ of Jordan (1913) [3°58'12''S,79°3'42''W], 1800 m, 20 Feb 1996, 1 ♂, (PIBO); km 4.3 San Andrés- and Potts (1943)) along veins and in cells except for distal half of cells anterior Jimbura rd., [4°47'59''S,79°18'18''W], 2020 m, (Willmott, K. R.), 13 Oct 2010, of vein Cu1. Head: eyes black, bare; antennae black with sparse black needle- 1 ♂ [FLMNH-MGCL-146465], (FLMNH); km 5.3 San Andrés-Jimbura rd., like scales dorsally, 31 antennomeres with terminal 9 antennomeres comprising Finca San Carlos, [4°47'53''S,79°18'34''W], 2000 m, (Willmott, K. R.), 15 club; labial palpi with very sparse, long, black, hair-like scales perpendicular to Oct 2010, 1 ♂ [FLMNH-MGCL-145574], 1 ♂ [FLMNH-MGCL-146462], palpus surface on basal and middle segment, very sparse black scales laterally 1 ♂ [FLMNH-MGCL-146464], 1 ♂ [FLMNH-MGCL-146466], 1 ♂ on middle segment; top of head black, frons with sparse, long, black, hair-like [FLMNH-MGCL-146467], 1 ♀ [FLMNH-MGCL-145573], 1 ♀ [FLMNH- scales. Thorax: dorsal surface black, ventral surface black, forelegs, mid- and MGCL-146461], 1 ♀ [FLMNH-MGCL-146463], (FLMNH), 1 ♂, (INABIO); hind legs black. Abdomen: dorsal surface black, ventral surface black except km 6 San Andrés-Jimbura rd., Quebrada Troya, [4°47'32''S,79°18'42''W], 2050 for spots of orange scaling in middle of each sternite in anterior half, and line m, (Willmott, K. R., J. C. R., J. I. R.), 20 Jun 2014, 1 ♂ [FLMNH-MGCL-280788], of orange scaling laterally dorsal of sternites. Genitalia (Fig. 3B): as illustrated 1 ♂ [FLMNH-MGCL-280791], (FLMNH), 5 ♂, (INABIO), 21 Jun 2014, 1 ♂ (Fig. 3B). Notable features include the gently curving uncus, lack of gnathos, [FLMNH-MGCL-195833] , 1 ♂ [FLMNH-MGCL-195834] , 1 ♂ [FLMNH- sharply curving valvae, and the aedeagus with a sclerotized ring just anterior MGCL-195835] , 1 ♂ [FLMNH-MGCL-195836], (FLMNH), 5 ♂, (INABIO), of the manica attachment. The juxta is a rather irregular, approximately “V”- 29 May 2013, 1 ♂ [FLMNH-MGCL-157826], 1 ♂ [FLMNH-MGCL-157827], shaped plate. (FLMNH), 8 ♂, (INABIO); km 7 San Andrés-Jimbura rd., trail to Río Bolívar, [4°47'11''S,79°18'50''W], 2050 m, (Willmott, K. R., J. C. R., J. I. R.), 31 May 2013, FEMALE: (Fig. 2N,O): Forewing length 27-28 mm, mean 27.4 mm (n=5). Wing 1 ♂, (INABIO); Loja-Zamora rd., [3°59'30''S,79°8'12''W], 2700-2800 m, Jun shape and color pattern: similar to male except wings slightly more elongate, 1998, 2 ♂, (PIBO); Loja-Zamora rd., Río San Francisco, [3°58'42''S,79°6'6''W], orange markings typically more extensive. Head, thorax, abdomen: similar 1900 m, (Willmott, K. R.), 28 Oct 1997, 1 ♂, (KWJH); nr. Sabanilla, Loja- to male in coloration. Four out of six examined females with a sphragis, a Zamora rd., Quebrada San Ramón, power station, [3°58'12''S,79°3'42''W], curving, rectangular plate, terminating ventrally in a tuft of scales perpendicular (Willmott, K. R., Hall, J. P. W.), 13 Aug 2009, 1 ♂ [FLMNH-MGCL-145143], to abdomen (Fig. 3H); dissected specimen lacked a sphragis. Genitalia (Fig. 1 ♂ [FLMNH-MGCL-145144], 1 ♂ [FLMNH-MGCL-145145], 1 ♂ [FLMNH- 3C-G): as illustrated (Fig. 3C-G). Notable features include lamella ante- and MGCL-145146], 1 ♂ [FLMNH-MGCL-145147], (FLMNH); Quebrada Zurita, postvaginalis fused into a single approximately circular plate with circular old Loja-Zamora rd., [3°58'1''S,79°6'53''W], 2100 m, (Willmott, K. R., J. C. R., ostium bursae (Fig. 3D); lamella antevaginalis wrinkled and covered with tiny J. I. R.), 1 Jul 2014, 1 ♂ [FLMNH-MGCL-280789], (FLMNH); Río Sabanilla, protusions and spines; antrum a weakly sclerotized, small band; ductus bursae [3°58'12''S,79°3'42''W], 1300 m, (Jasinski, A.), 19 May 1996, 1 ♂, (MZUJ); very short, ductus seminalis thin, corpus bursae small, similar in size to lamella "Zamora, 915-1220 m", (Baron, O.), 9 ♂, (NHMUK); Zamora-Loja rd., San antevaginalis plus lamella postvaginalis (Fig. 3E); subpapillary glands similar Francisco, canal subterráneo, [3°58'44''S,79°5'W], 1800 m, (Willmott, K. R.), in size to papillae anales (Fig. 3E,G). 04 Feb 2002, 1 ♂, (KWJH). Types: HOLOTYPE ♂: ECUADOR: Zamora-Chinchipe: nr. Sabanilla, Loja- Other examined specimens (3 ♂): Ecuador: ‘Ecuador’, 1 ♂ [‘Ecuador Zamora rd., Quebrada San Ramón, power station, [3°58'12''S,79°3'42''W], Hewitson Coll. 79-69 Acraea radiata, Hew. 1.//Ecuad.’], 1 ♂ [‘Ecuador (K.R. Willmott & J. P. W. Hall), 13 Aug 2009, 1 ♂ [FLMNH-MGCL-145142], Hewitson Coll. 79-69 Acraea radiata, Hew. 2.//Ecuad.’], (paralectotypes of (FLMNH, to be deposited in INABIO). Acraea radiata, NHMUK); ‘S Ecuador’, 1 ♂, (NHMUK). Paratypes (66 ♂, 7 ♀): Ecuador: Loja: km 15 Loja-Zamora rd., 2600- Etymology: This species is named for Kenneth John Coulson, 2800 m, 20 Feb 1996, 1 ♂, (PIBO); 'Loja' - (error), 1 ♂, (NHMUK); who has been for many years a firm and generous friend with Morona-Santiago: 42 km W Méndez, 1600 m, (Petit, J.-C..), 14 Oct 2009, a great spirit of adventure and a boundless sense of humor 1 ♀, (JEPE); km 22 Limón-Gualaceo rd., [3°0'30''S,78°32'20''W], 2100 m, (Willmott, K. R.), 10 Nov 2010, 1 ♂ [FLMNH-MGCL-145572], 1 ♂ (KRW). [FLMNH-MGCL-146406], (FLMNH); km 25 Macas-Nueve de Octubre rd., [2°15'42''S,78°12'54''W], 1600-2100 m, (Boyer, P.), 6 Dec 1998, 1 ♂, (PIBO); Taxonomy and variation: The first question to be addressed km 44.5 Gualaceo-Limón rd., Río Gualaceño, [3°1'26''S,78°38'7''W], 2175 m, is whether the two apparently distinct wing pattern phenotypes (Willmott, K. R.), 7 Oct 2007, 1 ♂ [FLMNH-MGCL-113346], 1 ♂ [FLMNH- MGCL-113348], 1 ♂ [FLMNH-MGCL-113350], (FLMNH); Limón-Gualaceo seen in sympatric series from Ecuador represent variation rd., [3°0'30''S,78°34'6''W], 2200 m, (Wojtusiak, J., Pyrcz, T.), 31 Aug 2003, or distinct species. The DNA barcode data strongly support 1 ♂, (MZUJ); San Martín, Chigüinda, [3°13'41''S,78°41'59''W], 2030 m, the latter (Fig. 1). Barcoded specimens of both species were (Willmott, K. R.), 11 Oct 2007, 1 ♂ [FLMNH-MGCL-113347], (FLMNH); collected in micro-sympatry at four sites, and in broader Zamora-Chinchipe: Destacamento Paquisha Alto, [3°54'28''S,78°29'5''W], 2100 m, (Radford, J.), 3 Sep 2010, 1 ♀ [PAN112], (FLMNH) (CULEPEX sympatry throughout the range of A. johncoulsoni, and these Expedition, 2010); km 17.6 San Andrés-Zumba rd., Quebrada de los Rubies, grouped into two distinct clusters with a mean between-group [4°52'37''S,79°12'34''W], 1660 m, (Willmott, K. R., J. C. R., J. I. R.), 22 Jun pairwise distance of 2%, and mean within-group pairwise 2014, 1 ♂ [FLMNH-MGCL-280790], (FLMNH); km 18 Yacuambí-Saraguro distance of 0.1% (A. johncoulsoni) and 0.5% (A. intensa). rd., Cascada Hampik Yaku, [3°33'56''S,78°58'6''W], 2000 m, (Willmott, K. R., J. C. R., J. I. R.), 21 Jun 2013, 1 ♀ [FLMNH-MGCL-157825], (FLMNH); km Fig. 2 (facing page). Actinote intensa and A. johncoulsoni n. sp. Numbered arrows refer to characters in Table 1. A-I, Actinote intensa. Split specimens show dorsal surface on left, ventral surface on right. A,B: Lectotype male of Actinote radiata intensa, Peru, [Pasco], Cushi, NHMUK: A, dorsal surface, B, ventral surface and specimen labels (Courtesy of the Trustees of the Natural History Museum). C,D: Lectotype male of Acraea radiata and Acraea (Abananote) intensa gerardolamas, Ecuador: C, dorsal surface, D, ventral surface and specimen labels (Courtesy of the Trustees of the Natural History Museum). E: male, Peru, Amazonas, Pomacochas (LEP-04015). F: male, Ecuador, Zamora-Chinchipe, Quebrada San Ramón (LEP-37581). G: male, Ecuador, Zamora-Chinchipe, Quebrada San Ramón (LEP-04018). H: male, Ecuador, Morona- Santiago, Río Retiro (LEP-00017). I: paralectotype female of Acraea radiata, Ecuador, NHMUK (Courtesy of the Trustees of the Natural History Museum). J-O, Actinote johncoulsoni. J,K. Holotype male of Actinote johncoulsoni n. sp., Ecuador, Zamora-Chinchipe, Quebrada San Ramón: J, dorsal surface, K, ventral surface and specimen labels. L: male, Ecuador, Zamora-Chinchipe, Quebrada Troya (LEP-37567). M: male, Ecuador, Zamora-Chinchipe, Quebrada Troya (LEP-37438). N: female, Ecuador, Zamora-Chinchipe, San Francisco (LEP-37582). O. female, Ecuador, Zamora-Chinchipe, Finca San Carlos (LEP-37577). 12 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote Fig. 3. Genitalia of Actinote intensa and A. johncoulsoni n. sp. A: A. intensa, ♂, lateral view genitalia and posterior view juxta (upper right), dissection # KW-15-142, Ecuador, Quebrada San Ramón. B: A. johncoulsoni, holotype ♂, lateral view genitalia and posterior view juxta (upper right), dissection# KW-15-146, Ecuador, Quebrada San Ramón. C-G: A. johncoulsoni, ♀ (KW-15-146; LEP-04156): C: lateral view posterior tip abdomen. D: ventral view posterior tip abdomen. E: abdomen interior and genitalia dorsal view; F: lamella antevaginalis, corpus bursae and ductus bursae lateral view. G: papillae anales and subpapillary glands lateral view. H: A. johncoulsoni, ♀ (LEP-37434): lateral view abdomen tip showing sphragis (indicated by arrow). The second question is how to apply existing names to the type of intensa and, to a greater extent, more recently collected two species. The barcoded groups enabled the identification of Peruvian specimens tend to have more pinkish coloration in a number of wing pattern characters (Table 1) that allowed us the FW band than Ecuadorian specimens, thus more closely to assign the names intensa, radiata and gerardolamas to one resembling A. johncoulsoni. However, other characters, species, leaving the second species to be described here. The especially the equally sized, paired orange VFW tornal spots, WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 13 point to Peruvian specimens being conspecific with Ecuadorian Habitat and ecology: Actinote johncoulsoni occurs in the specimens identified here as A. intensa. Furthermore, same cloud forest habitats (Fig. 5A) as its sister species A. barcoded specimens from northern Peru (e.g., Fig. 2E) that intensa, from 1600-2200 m, and the two species are often are phenotypically similar to the type of intensa grouped with found together. Like A. intensa, males may be found flying Ecuadorian A. intensa and not A. johncoulsoni. 2-6 m above streams, puddling at damp sand and gravel (Fig. The final question is whether A. johncoulsoni could be a 5B,C), especially where there is urine or rotting carrion, and subspecies of an existing species. Actinote johncoulsoni and are occasionally found in traps baited with rotting fish. Females A. intensa share a number of morphological characters, as are much rarer in nature; single individuals have been observed discussed in the diagnosis of A. intensa, suggesting that they flying across open ridge tops and along rivers (J. Radford, pers. are sister species. Based on the very similar genitalia (shape comm.; pers. obs.), and we collected one individual (Fig. 2N) of valva and uncus), and shared black hair-like scales on the puddling along a river. VHW, the closest relative to A. intensa+A. johncoulsoni is likely to be A. abana, a species sympatric with A. johncoulsoni. ACKNOWLEDGMENTS Actinote erinome is distributed allopatrically with respect to A. johncoulsoni, from northern Peru to Bolivia, but both genetic We thank the museum curators and individuals who allowed data (Fig. 1) and male genitalic characters (straighter uncus us to examine the Actinote collections under their care, in with hooked tip, more up-turned valva, lack of sclerotized band particular Jean-Claude Petit, Tomasz Pyrcz, Blanca Huertas and around aedeagus anterior of manica, examined in specimens of Pierre Boyer. We thank Santiago Villamarín, the INABIO and A. erinome mathani Oberthür, 1917, A. erinome erinome, and Ecuadorian Ministerio del Ambiente for arranging the necessary A. erinome testacea (Salvin & Godman, 1868)) suggest that permits for research in Ecuador. Museum and field work was these are distinct species. funded in part by the Leverhulme Trust, the Darwin Initiative, Both the width and pinkish tinge of the DFW band in the National Science Foundation (# 0847582) and the FLMNH A. johncoulsoni vary (Fig. 2J,L,M), without any apparent Museum Associates, and field work by the National Geographic geographic correlation. Society (Research and Exploration Grant # 5751-96) and NSF (# 0103746, #0639977, #0639861). For their company in the field and for collecting specimens of Actinote we thank Raúl Aldaz, Jamie Radford, and Julia and Jamie Robinson Willmott. We thank Lei Xiao for help in the molecular lab and Maris Midgley for permission to print her photographs of live Actinote. Finally, we thank André Freitas, Eduardo Barbosa and Marlon Paluch for their helpful reviews of the mansucript. LITERATURE CITED Comstock, J. H., Needham, J. G. 1918. The wings of insects. American Naturalist 32: 231-257. D’Abrera, B. 1987. Butterflies of the Neotropical Region. Part III. Brassolidae, Acraeidae & Nymphalidae (partim). Victoria, Black Rock, Hill House. pp. viii + 385-525. Elias, M., Hill, R., Willmott, K. R., Dasmahapatra, K., Brower, A., Mallet, J., Jiggins, C. 2007. Limited performance of DNA barcoding in a diverse community of tropical butterflies. Proceedings of the Royal Society of London B 274: 2881-2889. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294-299. Francini, R. B., Freitas, A. V. L., Penz, C. M. 2004. Two new species of Actinote (Lepidoptera, Nymphalidae) from southeastern Brazil. Zootaxa 719: 1–10. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98. Fig. 4. Distribution of Actinote intensa and A. johncoulsoni n. sp. Hebert, P. D. N., Cywinska, A., Ball, S. L. deWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270: 596-599. Distribution: Actinote johncoulsoni has been recorded in Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H., Hallwachs, Morona-Santiago and Zamora-Chinchipe provinces in eastern W. 2004. Ten species in one: DNA barcoding reveals cryptic species in Ecuador (Fig. 4). Its presence at sites in Ecuador that are within the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the 5 km of the Peru border suggest that it almost certainly occurs National Academy of Sciences of the USA 101: 14812-14817. in the latter country. 14 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote Fig. 5. Habitat and live Actinote. A: Ecuador, Zamora-Chinchipe, upper valley of Río San Francisco, the vicinity of the type locality, where both A. intensa and A. johncoulsoni occur. B,C: A. johncoulsoni n. sp., Ecuador. D,E: A. intensa, Ecuador. Photographs B,C by Maris Midgley. Hewitson, W. C. 1868. Illustrations of new species of exotic butterflies, J. B. (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Gainesville, selected chiefly from the collections of W. Wilson Saunders and William Association for Tropical Lepidoptera; Scientific Publishers. C. Hewitson. London, John Van Voorst. 4(66): [31-34], [49-50], pls. [18- Monteiro, A., Pierce, N. 2001. Phylogeny of Bicyclus (Lepidoptera: 19], [27]. Nymphalidae) inferred from COI, COII and EF1a gene sequences. Jordan, H. E. K. 1910. New forms of the Acraeine genera Planema and Molecular Phylogenetics and Evolution 18: 264-281. Actinote. Novitates Zoologicae 17: 462-469. Neild, A. F. E. 2008. The Butterflies of Venezuela. Part 2: Nymphalidae Jordan, H. E. K. 1913. I. Unterfamilie: Acraeinae, pp. 358-374. In: Seitz, II (Acraeinae, Libytheinae, Nymphalinae, Ithomiinae, Morphinae). A. (Ed.), Die Gross-Schmetterlinge der Erde, Vol. V. Stuttgart, Alfred A Comprehensive Guide to the Identification of Adult Nymphalidae, Kernen. Papilionidae, and Pieridae. London, Meridian Publications. Kemal, M., Koçak, A. Ö. 2007. A replacement name for a Neotropical Neild, A. F. E., Nakahara, S., Zacca, T., Fratello, S. A., Lamas, G., Le Crom, butterfly (Acraeidae, Lepidoptera). Miscellaneous Papers. Centre for J.-F., Dolibaina, D. R., Dias, F. M. S., Casagrande, M. M., Mielke, O. Entomological Studies 106: 2-3. H. H., Espeland, M. 2015. Two new species of Euptychia Hübner, 1818 from the Upper Amazon basin (Lepidoptera, Nymphalidae, Satyrinae). Kumar, S., Stecher, G., Tamura, K. 2016. MEGA7: Molecular Evolutionary ZooKeys 541: 87-108. Genetics Analysis Version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. Paluch, M., Casagrande, M. M., Mielke, O. H. H. 2006. Três espéces e duas subespéces novas de Actinote Hübner (Nymphalidae, Heliconiinae, Lamas, G. [1997]. Lista comentada de los nombres propuestos para los Acraeini). Revista Brasileira de Zoologia 23: 764–778. Acraeini neotropicales, y su material-tipo (Lepidoptera: Nymphalidae, Heliconiinae). Revista Peruana de Entomología 39: 29-48. Penz, C. M. Francini, R. B. 1996. New species of Actinote Hübner (Nymphalidae: Acraeinae) from southeastern Brazil. Journal of the Lamas, G. 2004. Nymphalidae. Heliconiinae, pp. 261-274. In: Lamas, G. Lepidopterists’ Society 50: 309–320. (Ed.), Checklist: Part 4A. Hesperioidea - Papilionoidea. In: Heppner, WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 15 Pierre, J. 1987. Systématique cladistique chez les Acraea (Lepidoptera, Nymphalidae). Annales de la Société Entomologique de France 23: 11– 27. Potts, R. W. L. 1943. Systematic notes concerning American Acraeinae (Lepidoptera: Nymphalidae). Pan-Pacific Entomologist 19: 31-32. Scoble, M. 1992. The Lepidoptera: Form, Function and Diversity. London, Oxford University Press. ix + 352 pp. Silva-Brandão, K. L., Wahlberg, N., Francini, R. B., de Azeredo-Espin, A. M. L., Brown, K. S., Paluch, M., Lees, D. C., Freitas, A. V. L. 2008. Phylogenetic relationships of butterflies of the tribe Acraeini (Lepidoptera, Nymphalidae, Heliconiinae) and the evolution of host plant use. Molecular Phylogenetics and Evolution 46: 515-531. Willmott, K. R., Freitas, A. V. L., Hall, J. P. W., Silva-Brandão, K. L., Paluch, M. 2009. A new species of Actinote Hübner from the eastern Andes of Ecuador (Lepidoptera: Nymphalidae: Heliconiinae). Proceedings of the Entomological Society of Washington 111: 47-56. Appendix 1. Voucher specimen information for DNA sequence data. Sequences with DNA voucher numbers beginning “LEP-” or “KW-” are newly deposited in GenBank, the remainder were available in GenBank prior to this study. Taxon names for samples obtained from GenBank are reproduced unaltered from the sequence title. Taxon Locality (decimal latitude and longitude) DNA voucher GenBank number number Actinote johncoulsoni Ecuador: Morona-Santiago: km 22 Limón-Gualaceo rd. (-3.008, -78.539) LEP-06920 KY649591 Actinote johncoulsoni Ecuador: Morona-Santiago: Río Gualaceño(-3.024, -78.635) KW-071009-79 KY649575 Actinote johncoulsoni Ecuador: Morona-Santiago: San Martín, Chigüinda (-3.228, -78.7) LEP-00016 KY649577 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Cascada Hampik Yaku (-3.566, -78.968) LEP-37434 KY649593 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-04156 KY649589 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-04157 KY649590 Actinote johncoulsoni Ecuador: Zamora-Chinchipe:Finca San Carlos (-4.798, -79.309) LEP-37571 KY649602 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-37572 KY649603 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-37574 KY649604 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-37576 KY649606 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Finca San Carlos (-4.798, -79.309) LEP-37577 KY649607 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: km 4.3 San Andrés-Jimbura rd. (-4.8, -79.305) LEP-37575 KY649605 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37569 KY649600 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37570 KY649601 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37437 KY649594 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37438 KY649595 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37565 KY649596 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37566 KY649597 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37567 KY649598 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: Quebrada Troya (-4.792, -79.312) LEP-37568 KY649599 Actinote johncoulsoni Ecuador: Zamora-Chinchipe: San Francisco, casa de Arcoiris (-3.988, -79.095) LEP-37582 KY649612 Actinote eresia leptogramma Ecuador: Zamora-Chinchipe: Quebrada Navidades (-3.975, -79.125) LEP-00020 KY649580 Actinote hilaris desmiala Ecuador: Carchi: Reserva Forestal Golondrinas (0.826, -78.112) LEP-04153 KY649588 Actinote intensa Ecuador: Loja: Quebrada Gurunamaca (-4.422, -79.143) LEP-00014 KY649576 Actinote intensa Ecuador: Morona-Santiago: Guarumales/Hidropaute (-2.569, -78.514) LEP-06921 KY649592 Actinote intensa Ecuador: Morona-Santiago: Quebrada Cugusha,km 37 Macas-Cebadas rd. (-2.225, -78.291) LEP-00018 KY649579 Actinote intensa Ecuador: Morona-Santiago: Río Gualaceño (-3.024, -78.635) LEP-37583 KY649613 Actinote intensa Ecuador: Morona-Santiago: Río Retiro, km 42 Macas-Cebadas rd. (-2.2, -78.317) LEP-00017 KY649578 Actinote intensa Ecuador: Morona-Santiago: Río Retiro, km 42 Macas-Cebadas rd. (-2.2, -78.317) LEP-37585 KY649615 Actinote intensa Ecuador: Morona-Santiago: Río Retiro, km 42 Macas-Cebadas rd. (-2.2, -78.317) LEP-37586 KY649616 Actinote intensa Ecuador: Morona-Santiago: San Martín, Chigüinda (-3.228, -78.7) LEP-37584 KY649614 Actinote intensa Ecuador: Tungurahua: Baños-Pondoa (presumed mislabeled from Peru) LEP-04013 KY649582 Actinote intensa Ecuador: Zamora-Chinchipe: km 12 old Zamora-Loja rd. (-4.022, -79.013) LEP-04017 KY649586 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-04016 KY649585 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-04018 KY649587 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37578 KY649608 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37579 KY649609 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37580 KY649610 Actinote intensa Ecuador: Zamora-Chinchipe: Quebrada San Ramón, power station (-3.97, -79.062) LEP-37581 KY649611 Actinote intensa Ecuador: Zamora-Chinchipe: San Francisco, casa de Arcoiris (-3.988, -79.095) LEP-37587 KY649617 Actinote intensa Peru: Amazonas: Pomacochas (-5.817, -77.967) LEP-04015 KY649584 Actinote intensa Peru: Amazonas: 'Rodríguez de Mendoza' [= Mendoza] (-6.4, -77.483) LEP-04012 KY649581 Actinote intensa Peru: Amazonas: 'Rodríguez de Mendoza' [= Mendoza] (-6.4, -77.483) LEP-04014 KY649583 Abananote erinome erinome Peru: Junín (Silva-Brandão et al., 2008) AC34 EU275516.1 Abananote radiata Ecuador: Morona-Santiago: Macas-Guamote rd. (Silva-Brandão et al., 2008) NW90-12 EU275517.1 Altinote alcione sodalis Peru: Junín (Silva-Brandão et al., 2008) AC28 EU275554.1 Altinote dicaeus albofasciata Ecuador: Napo (Silva-Brandão et al., 2008) E-51-18 EU275555.1 Altinote dicaeus callianira Peru: Junín (Silva-Brandão et al., 2008) AC25 EU275556.1 Altinote dicaeus callianira Peru: Junín (Silva-Brandão et al., 2008) AC58 EU275557.1 Altinote dicaeus flavibasis Colombia: Putumayo (Silva-Brandão et al.,2008) C-17 EU275558.1 Altinote eresia Bolivia: Cochabamba (Silva-Brandão et al., 2008) AC87 EU275559.1 Actinote momina Peru: Cuzco (Silva-Brandão et al., 2008) RV-03-V240 EU275560.1 Actinote negra demonica Bolivia: Yungas: Coroico (Silva-Brandão et al., 2008) AC46 EU275561.1 Altinote negra euclia Peru: Cajamarca (Silva-Brandão et al., 2008) AC64 EU275562.1 Altinote neleus Colombia: Antioquia: Sabaneta (Silva-Brandão et al., 2008) AC16 EU275563.1 Altinote rubrocelullata Peru: Ancash (Silva-Brandão et al., 2008) AC76 EU275564.1 Altinote tenebrosa Ecuador: Sucumbíos: La Bonita (Silva-Brandão et al., 2008) NW90-15 EU275565.1 Altinote negra demonica Peru: Cuzco: Santa Teresa (Silva-Brandão et al., 2008) AC45 EU275573.1 Actinote pellenea Brazil: SãoLuis de Paratiga (www.nymphalidae.net/db.php) NW129-23 KM012923.1