ebook img

Notes on identity, new synonymy and larva of Ivalia Jacoby (Coleoptera: Chrysomelidae) with description of a new species PDF

2006·1.3 MB·English
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Notes on identity, new synonymy and larva of Ivalia Jacoby (Coleoptera: Chrysomelidae) with description of a new species

Zootaxa 1363: 49–68 (2006) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ ZOOTAXA 1363 Copyright © 2006 Magnolia Press ISSN1175-5334(online edition) Notes on identity, new synonymy and larva of Ivalia Jacoby (Coleoptera: Chrysomelidae) with description of a new species CATHERINE N. DUCKETT1, K. D. PRATHAPAN2 & ALEXANDER S. KONSTANTINOV3 1Department of Entomology, Smithsonian Institution P.O. Box 37012, National Museum of Natural History, MRC 168, Washington, DC 20013-7012, U.S.A. (Current address: Entomology Department, Rutgers Univer- sity, New Brunswick, NJ 08901). E-mail: [email protected] 2Department of Entomology, Kerala Agricultural University, Vellayani P.O., Trivandrum 695 522, Kerala, India. E-mail: [email protected] 3Systematic Entomology Laboratory, PSI, Agricultural Research Service, U.S. Department of Agriculture, c/o Smithsonian Institution P.O. Box 37012, National Museum of Natural History, MRC 168, Washington, DC 20013-7012, U.S.A. E-mail: [email protected] Abstract Genus Ivalia Jacoby is characterized morphologically, and Amphimeloides Jacoby syn. nov. and Taizonia Chen syn. nov. are junior synonyms with it. Several Ivalia species are figured, including Ivalia bella (Chen) comb. nov.,I. dorsalis (Jacoby) comb. nov., and I. viridipennis Jacoby. A new species of Ivalia from the Nilgiri Hills in south India, I. korakundah sp. nov., is described and illustrated, including the larvae. Larvae were associated with adults by sequencing a fragment of the mitochondrial gene cytochrome oxidase I. Larval morphology is discussed and compared with that of other flea beetles. Key words: Chrysomelidae, Ivalia, Taizonia, Amphimeloides, moss feeding, larval sensilla, new species Introduction Jacoby (1887:100) proposed Ivalia to accommodate “small species of Halticinae having general shape and appearance of Apteropeda, but differing from that … by the irregularly punctured elytra and the appendiculate claws”. A few pages earlier in the same paper Jacoby described another genus, Amphimeloides. Unfortunately and inexplicably, he did not compare the two, although both are described from Sri Lanka and share some important characters including small size with a similarly round and convex body, open procoxal cavities, irregularly punctured elytra, appendiculate claws, and a long metatibial Accepted by V. Grebennikov: 9 Oct. 2006; published: 23 Nov. 2006 49 ZOOTAXA spur. Instead Ivalia was compared with Apteropeda, a European genus with a relatively 1363 small range, while Amphimeloides was compared with Amphimela, an Asian genus, obviously different from the taxon under consideration in various features. Taizonia was described some years later (Chen 1934) and it is unclear how much comparative data was used to establish that genus. The most complete up-to-date treatment of Taizonia was published by Gruev and Askevold (1988), who synonymized Medvedev’s Schereria, transferring Chabria minima Scherer (the type species of Schereria) and Schereria martensi Medvedev to Taizonia. Gruev and Askevold (1988) also described two new species of Taizonia from India and provided a key to all ten Taizonia species known to date. Similarity between Taizonia and Ivalia was first noted by Medvedev (2001). After studying Ivalia metallica Jacoby and I. ruficollis (Motschulsky), he commented that they were similar to Taiwanese Taizonia in their “saddle-like” metasternum, long first metatarsomere and dorsal surface of metatibia varying from grooved to flattened sometimes with ridges. He noticed that Indian Taizonia has a slightly shorter first metatarsomere. However, he did not propose any synonymy. In this study we aim to increase morphological understanding of Ivalia, propose new synonyms, describe a new species from south India, and describe the larva of Ivalia. Materials and methods Traditional techniques were used to dissect specimens and prepare them for scanning electron microscopy. For adults, scanning electron microscopy was performed on uncoated material at 10Kv. Male abdomen and pterothorax were cleared using DNA extraction enzymes (Qiagen™ 'DNAeasy tissue kit') prior to mounting (Figs 3C-G). Larvae were critical point dried and coated with gold palladium and also imaged at 10Kv. DNA was extracted, amplified, and purified using Qiagen™ extraction, PCR, and purification kits. The PCR protocol included 40 cycles, the first 10 cycles with an annealing temperature of 46° and the subsequent 30 at 48°C. Otherwise the PCR protocol was standard. DNA was prepared for sequencing in an ABI 3100 plate sequencer using ABI Big dye 3.1chemistry. Identity of the larval beetles was established by sequencing a fragment of the COI locus using primers modified from Simon et al. (1994) designed to amplify base pairs between nucleotides 1709–2355, 1718–2329 and 1751–2203. Forward primers are: COI 1709F 5'TAATTGGAGGATTTGGWAAYTG—3', COI 1718F 5'GGAGGATTTGGAAATTGATTAGTTCC—3'. COI 1751F 5—GGA TCA CCT GAT ATA GCA TTC CC—3'. Reverse primers are: COI—2191R 5'—CCYGGTAAAATTAAAATATAAACTTC—3', COI 2203R 5'—AATTARAATATAWACTTCWGRTG—3', 50 © 2006 Magnolia Press DUCKETTET AL. COI 2329R 5'—ACTGTAAATATATGATGAGCTCA—3', ZOOTAXA 1363 COI 2355R 5'—GCTCGTGTATCWACGTCTAT—3'. Two adults and two larvae were sequenced twice using two different primer pairs; Ivalia sp. 1 from Ponmudi, Kerala was also sequenced twice for comparison. We obtained a 547 bp piece from amplicons resulting from the use of these pairs, which we considered reliably sequenced. This consensus sequence for each individual was aligned using Clustal W (Thompson et al. 1994) to the sequences of the other individuals. This alignment was tested for accuracy by translation to amino acids using the MacClade (Maddison & Maddison 2001) program. Ivalia korakundah sequences are deposited in Genbank under accession numbers DQ080034–DQ080037 and Ivalia sp. 1 under accession DQ080038. Voucher material from extracted specimens is deposited at USNM. Descriptive terminology of the adults follows Konstantinov (1998) and that of larvae follows Duckett and Casari (2002), Duckett and Swigonova (2002) and LeSage and Zmudzinska-Krzesinska (2004). The following institution abbreviations are used in this paper: BMNH — The Natural History Museum, London, United Kingdom; DEIM — Deutsches Entomologisches Institut, Müncheberg, Germany; NHMB — Natural History Museum, Basel, Switzerland; PKDC — K. D. Prathapan personal collection, Trivandrum, India; SMFM — Senckenberg Museum Frankfurt/Main, Germany; USNM — National Museum of Natural History, Washington, DC, USA. CND is responsible for the molecular part of this project and for the larval description; the taxonomic part is the work of the junior authors. Ivalia Jacoby (Figs 1–8) Ivalia Jacoby, 1887:100 (type species Ivalia viridipennis Jacoby 1887 designated by Maulik (1926), type locality Sri Lanka, type in BMNH). Ancyloscelis Ogloblin, 1930:100–101 (type species Mniophila ruficolle Motschulsky 1866 by monotypy, type locality Sri Lanka, type probably lost). Scherer, 1969:234 (synonymy). Amphimeloides Jacoby, 1887:95 (type species Amphimeloides dorsalis Jacoby 1887:96 by mono- typy, type locality Sri Lanka, type in BMNH). New synonym. Taizonia Chen, 1934:182 (type species Taizonia bella Chen 1934 by original designation, type locality Taiwan, type in DEIM). New synonym. Schereria Medvedev, 1984:60 (type species Chabria minima Scherer 1984 by original designation, type locality Nepal, holotype in NHMB). Gruev & Askevold, 1988:140 (synonymy). Notes on generic synonymy. Based on the study of various specimens, including type specimens of the type species, we conclude that Taizonia and Amphimeloides are junior synonyms of Ivalia. They share the following character extremely rare among flea beetles: metasternum is expanded anteriorly, becoming vertical and covering mesosternum (Fig. 5A) so the latter also becomes vertical and sometimes invisible in ventral view. This character is shared by the types of all the type species, but varies slightly among other NOTES ON IVALIA © 2006 Magnolia Press 51 ZOOTAXA studied species of Ivalia. In its most developed state, the character is known to occur only 1363 in Clavicornaltica Scherer (Konstantinov & Duckett 2005), also a humicole feeder but easily distinguishable from Ivalia by its clavate antennae and other features. Other uncommon characters occuring in Ivalia and some other Oriental genera include the following: a. Metatibia curved in dorsal view with long metatibial spur (Figs 1, 3E, F), first metatarsomere as long as or longer than two following tarsomeres combined (Figs 2D, 3F); b. Labrum deeply emarginated (Fig. 3A); c. Thoracic sternites with elevated processes; d. Head with frontal ridge wide and swollen together with anterofrontal ridge in one callosity (see Figs 2C, E, 3A–B); e. Antennal calli poorly separated from vertex and from each other, sometimes not separated at all (Figs 2C, E, and 3A); f. Anterolateral callosity of pronotum very long, commonly reaching midpoint of lateral margin of pronotum (Figs 1, 2); g. Vaginal palpi of female genitalia relatively short with proximal ends fused (Fig. 4E). Overall there are no characters to separate Ivalia, Amphimeloides, and Taizonia. As Ivalia is senior to Taizonia, Ivalia remains valid and because Amphimeloides and Ivalia were published in the same paper, we here choose Ivalia as the name to use. Diagnostic characters of Ivalia. Adult beetles small to medium sized (2–5mm), convex in lateral view. Color metallic or nonmetallic dark or light shades with spots or stripes. Antennal calli poorly to moderately developed, flat to slightly raised, anterior ends somewhat triangular, entering into interantennal space, sulci surrounding antennal calli poorly developed. Eyes small, lateral, orbit narrow, antennal sockets separated by a distance subequal to two times width of orbit or more. Frontal ridge short, wide, flat to moderately raised; anterofrontal ridge wide, flat to moderately raised. Antenna hardly reaching middle of elytron, distal antennomeres widened. Labrum deeply incised. Maxillary palp long, second and third palpomeres moderately thick, distally enlarged, last pointed. Pronotum transverse, without impressions, anterior coxal cavities open behind. Elytron with irregular punctures, posteriorly narrowed; epipleuron wide, horizontal, reaching near apex. Hind wing present or absent. Thoracic sternites with raised process in middle: prosternal intercoxal process with longitudinal vertically raised ridge along middle, process on metasternum usually circular. Metacoxa greatly enlarged, ventrally with a groove and ridge for reception of femur. Metatibia in dorsal view characteristically curved with either ends directed laterally; dorsal surface with sharp lateral margin and flat mesal margin. Tarsal claw appendiculate. Vaginal palpi joined at proximal end. Spermathecal duct not coiled. Material examined. Amphimeloides dorsalis Jacoby: Holotype. Labels: 1) Type HT; 2) Ceylon, G. Lewis, 1910–320; 3) Dikoya, 3,800–4,200 ft. 6.XII–16.I.82; 4) Amphimeloides dorsalis Jac.; 5) Right hind leg mounted in balsam, S. Maulik, 1929; 6) HT found in dwr. parts missing G. A. Samuelson det. 1974 (BMNH). Ivalia viridipennis Jacoby: Syntypes male and female. Labels: 1) Ceylon, G. Lewis, 1910–320; 2) Dikoya, 3,800–4,200 ft. 6.XII–16.I.82; 3) Syntype Ivalia viridipennis Jacoby (2 BMNH). 52 © 2006 Magnolia Press DUCKETTET AL. ZOOTAXA 1363 FIGURE 1. Dorsal habitus of Ivalia korakundah new species, total body length 1.8 mm. NOTES ON IVALIA © 2006 Magnolia Press 53 ZOOTAXA 1363 FIGURE 2. Ivalia species. A-D I. viridipennis, A, dorsal habitus, B, lateral habitus, C, anterior view of head, D, metathoracic leg; E, I. bella, frontal view of head; F, I. dorsalis, holotype, lateral habitus. Taizonia bella Chen: Holotype male. Labels: 1) Kankau (Koshun) Formosa, H. Sauter V. 1912; 2) Holotypus; 3) Taizonia bella n. g. n. sp. S. H. Chen det. (DEIM). Schereria martensi Medvedev: Holotype male. Labels: 1) 179a Kaski Dist., oberhalb, Dhumpus Berlese, 2100m, Martens & Ausobsky 8/10 Mai 80; 2) Holotypus; 3) Holotypus; 4) Schereria martensi m. L. N. Medvedev det. 1983; 5) Senckenberg Museum Frankfurt/Main (SMFM). 54 © 2006 Magnolia Press DUCKETTET AL. Ivalia korakundah Prathapan, Konstantinov and Duckett, new species ZOOTAXA (Figs 1, 3–8) 1363 Description of adult. Size moderate, length (excluding head) 1.8 to 2.0 mm, width 1.0 to 1.2 mm, oblong, narrowed between elytra and prothorax, elytra ovate. Color lemon yellow; fourth antennomere onwards piceous, last antennomere lighter than preceding one. Labrum and clypeus brownish. Eye black to crystal white, surrounded by dark brown ring that extends to gena, distinct only in specimens with lighter eyes. Pronotum with black medial longitudinal stripe hardly reaching anterior or posterior margin, narrowed at both ends, widest in anterior 1/3, margins indistinct as color gradually lightens and merges with surrounding yellow. Pronotal stripe variable in size and prominence. Each elytron with broad black stripe narrowing to either end, widest at anterior 1/3 followed by a transverse, deep emargination from middle of lateral side. In some specimens it almost divides elytral stripe into two. Lateral sides and margins of thoracic sternites tend to be dark brown, coxae light yellow. First three abdominal sternites concolorous with thoracic sternites. Head (Figs 1, 2A–B) hypognathous. Frons and vertex form slightly convex line in lateral view. Vertex with shallow, minute, moderate sized punctures. Supraorbital pore circular, not surrounded by shallow grooves or tiny setiferous punctures, bearing an upcurved seta slightly shorter than second antennomere. Antennal callus 1.5 times wider than long, length slightly exceeding diameter of antennal socket, slightly raised, anterior end almost obtusely angulate, entering into interantennal space. Midcranial suture absent. Supracallinal sulcus shallow, poorly developed. Suprafrontal sulcus weak but distinct. Midfrontal sulcus short, deep. Supraantennal sulcus narrow, stronger than suprafrontal sulcus. Supraorbital sulcus short, shallow, ill defined. Orbital sulcus distinct. Subgenal suture narrow, distinct. Orbit narrow, subequal to transverse diameter of antennal socket. Interantennal space about twice as wide as diameter of a socket, subequal to transverse diameter of eye. Frontal ridge short, wide, slightly convex; anterofrontal ridge broad, as high as frontal ridge, laterally as high as medially, anteriorly flat above clypeus with concave anterior margin (Fig. 3A). Frontal ridge and anterofrontal ridge together appear as flattened equilateral triangle, merging above clypeus. Lateral margin of frons with two closely placed rows of setae merging below antennal socket: mesal row with long and lateral row with short setae. Frontoclypeal suture with a row of long setae. Labrum (Figs 3A–B) with six setiferous pores arranged in a curved, transverse row; distance between middle four pores less than that between lateral pore and adjacent one. Margin of incision on labrum with short setae. Maxillary palp (Fig. 3B) exceeds basal two antennomeres in length; basal palpomere tiny, not longer than wide; second club-shaped, subequal to, or slightly longer than third; third club- shaped, thicker than second, widening towards apex; fourth thin, a little longer than half of third. Antennae hardly reach middle of elytron. First antennomere club-shaped; second thicker than third, slightly thinner than first, slightly longer than half of first; fourth NOTES ON IVALIA © 2006 Magnolia Press 55 ZOOTAXA slightly longer than second but shorter than third; fifth onwards antennomeres thickened; 1363 fifth subequal to third in length; fourth and sixth subequal in length; seventh slightly longer, much thicker than sixth; seventh subequal to eighth; ninth and tenth separately slightly shorter than eighth; tenth 1.4 times longer than wide; eleventh shorter than two times length of tenth. Pronotum 1.4 times wider than long, anteriorly wider than posteriorly, convex. Lateral margin weakly curved, anteriorly wider than posteriorly. Anterolateral callosity well developed, convex, as long as 1/3 of lateral margin including anterolateral callosity, anteriorly higher than posteriorly, seta-bearing pore situated on dorsal posterior face of callosity forming indistinct denticle at pore, diameter of pore exceeding width of lateral margin; posterior callosity protruding, about 1/3 as long as anterolateral callosity; seta on anterolateral callosity as long as lateral margin; seta on posterolateral callosity slightly longer than half of seta on anterolateral callosity. Anterior margin straight, posterior margin gently curved; disc with small punctures with extremely minute seta arising from each puncture visible at high magnification; minute as well as medium sized scattered punctures also present. Intercoxal prosternal process (Fig. 3B) narrow in middle, apically widened with rounded apex, projecting much beyond coxa. Length of intercoxal prosternal process from anterior margin of sternite to posterior end 3.6 times distance between anterior margin of prosternum to coxal cavity; width of intercoxal prosternal process at middle less than distance between anterior margin of prosternum to coxal cavity. Width of mesosternal intercoxal process subequal to half of distance between anterior margin of mesosternum to posterior end of intercoxal process (cf. Fig. 3C). Distance between anterior margin of mesosternum to mesocoxal cavity slightly less than width of mesosternal intercoxal process. Prosternum slightly longer than metasternum; mesosternum shorter than metasternum. Intercoxal prosternal process with a vertically elevated ridge along middle, ridge being indistinct in proximal half, pronounced beyond middle with longitudinal depressions on either side of ridge. Mesosternum with indications of a horse-shoe shaped raised process on top, but poorly developed in most specimens (Fig. 5A). Metasternum with a circular depression with well-defined, ring-like ridge surrounding it (Fig. 5A). Elytron without humeral callus, with maximum width at proximal 1/3, tapering to apex (Figs 1, 3D). Elytral apex apparently concave, forming acute angle with sutural margin. Lateral margin of elytron delimiting epipleuron dorsolaterally, reaches up to sutural margin; visible from above except in distal 1/4. Elytral punctures stronger than those on pronotum; interstices flat with small minute punctures, distance between punctures up to diameter of three punctures in middle of disc. Elytral punctures with minute seta visible under high power. Internal surface (Fig. 3D) uniformly invested with small granulations.Elytral binding patches absent.Mesoscutellum triangular, broader than long, impunctate. Pro- and mesotibiae without apical spine. Width of pro- and mesofemora subequal to maximum width of epipleuron. Profemur slightly shorter than protibia, ventral 56 © 2006 Magnolia Press DUCKETTET AL. side nearly flat, dorsally convex. Foretibia rounded in cross section, slender, proximally ZOOTAXA 1363 half as thick as distally. First protarsomere in male not distinctly wider than in female, ventrally flat, with short, pointed setae, long setae absent. Second protarsomere narrower than first; third longer than second, shorter than first, deeply bilobed; fourth slightly shorter than two times length of third, ventral side of third tarsomere with long capitate setae. Mesofemur slightly longer than mesotibia. Metafemur about two times longer than wide (Figs 1, 3C), posteriorly with a dorsal groove and a ventral ridge for reception of tibia. Metatibia slightly longer than metafemur. Metatibia curved in lateral view. Dorsal surface convex with flat apex; mesal margin of dorsal surface with a short row of sharp bristles at distal end; lateral margin with sharp, long spinules from distal end to middle or slightly beyond. Metatibia about 3.4 – 3.7 times longer than first metatarsomere. Metatibial spur 1.3 times longer than tarsal claw (Figs 3E–F). Third metatarsomere bearing specialized spatulate setae ventrally (Figs 3F–G). Claw long, narrow with a short appendix (Fig. 3F). Intercoxal process of first abdominal ventrite with oval depression in middle, bearing ridge on either side those join together anteriorly with acute process between metacoxae. Abdomen with five visible ventrites. Length of first abdominal ventrite along middle slightly more than length of next three ventrites combined; fifth ventrite longer than fourth but shorter than fourth and third combined (Fig. 4D). Last visible abdominal tergite of female nearly as wide as long, with a shallow groove along middle (Fig. 4C). Female genitalia with receptacle of spermatheca (Fig. 4A) cylindrical, about four times longer than wide, widest in middle, slightly narrowed towards either end; pump curved, vertical part very short, horizontal part about half as long as receptacle, without denticle at apex; duct originate away from receptacle, curved towards receptacle, hardly reaching middle of receptacle. Vaginal palpi (Fig. 4E) lightly sclerotized, proximally fused like a horse shoe, narrowed from proximal end to distal end, lateral and mesal margins hardly form acute angle, setae not longer than maximum width of a palpus, placed near apex and lateral margin; tignum (Fig. 4B) curved with a central canal, distal sclerotization broad, spoon shaped, without setae, proximal sclerotization laterally flattened, broad, but narrower than distal sclerotization. Aedeagus (Figs 5B–C) in ventral view proximally wider than distally, highly convex along ventral side with flat, raised, rounded apex; in lateral view, moderately curved, widest near middle with acute, strongly recurved apex. Tegmen Y-shaped. Remarks. This species can be distinguished from the two described species of south Indian Ivalia by the following characteristics, including coloration and tibial spinules. Ivalia obrieni (Gruev and Askevold) has a transverse dark basal band on the pronotum (I. korakundah has a black medial longitudinal stripe on pronotum) and black elytron with lateral yellow band (I. korakundah has a black band along middle of elytron, the band being transversely emarginated in middle). Ivalia indica (Gruev and Askevold) is entirely yellow brown without black stripes. Head of I. indica has four deep punctures arranged in a transverse row near posterior margin of antennal calli. Such punctures are absent in the NOTES ON IVALIA © 2006 Magnolia Press 57 ZOOTAXA other two species. Elytral punctures are also much stronger in I. indica than in other south 1363 Indian species. On the lateral edge of the dorsal surface of the metatibia, I. obrieni has 3–4 spines while I. korakundah has a row of more than ten spinules. FIGURE 3. Ivalia korakundah, adult. A, frontal view of head; B, ventral view of head and pronotum; C- G, Qiagen™ cleared material; C, dorsal view of pterothorax and abdomen, note tracheoles and metendosternite; D, interior view of elytron showing regular granulations; E, metatibial spur; F, ventral view of metatarsi; G, tarsal setae of third tarsomere, total width of image 25 microns. 58 © 2006 Magnolia Press DUCKETTET AL.

See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.