F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 RESEARCH ARTICLE Infectious pancreatic necrosis virus triggers antiviral    immune response in rainbow trout red blood cells, despite not being infective[version 2; peer review: 2 approved] Previously titled: "Piscine birnavirus triggers antiviral immune response in trout red blood cells, despite not being infective" Ivan Nombela 1, Aurora Carrion1, Sara Puente-Marin1, Veronica Chico1, Luis Mercado2, Luis Perez 1, Julio Coll3, Maria del Mar Ortega-Villaizan 1 1Instituto de Biología Molecular y Celular, Miguel Hernández University, Elche, Spain 2Institute of Biology, Catholic Pontifical University of Valparaiso, Valparaiso, Chile 3Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Madrid, Spain v2 First published: 07 Nov 2017, 6:1968 Open Peer Review https://doi.org/10.12688/f1000research.12994.1 Latest published: 13 Dec 2017, 6:1968 https://doi.org/10.12688/f1000research.12994.2 Approval Status 1 2 Abstract Background: Some fish viruses, such as piscine orthoreovirus and version 2 infectious salmon anemia virus, target red blood cells (RBCs), replicate (revision) inside them and induce an immune response. However, the roles of view 13 Dec 2017 RBCs in the context of infectious pancreatic necrosis virus (IPNV) infection  have not been studied yet. version 1 Methods: Ex vivo rainbow trout RBCs were obtained from peripheral 07 Nov 2017 view view blood, Ficoll purified and exposed to IPNV in order to analyze infectivity and immune response using RT-qPCR, immune fluorescence imaging, flow cytometry and western-blotting 1. Espen Rimstad , Norwegian University of techniques. Life Sciences, Oslo, Norway Results: IPNV could not infect RBCs; however, IPNV increased the Maria Dahle, Norwegian Veterinary Institute, expression of the INF1-related genes ifn-1, pkr and mx genes. Moreover, conditioned media from IPNV-exposed RBCs conferred Oslo, Norway protection against IPNV infection in CHSE-214 fish cell line. Conclusions: Despite not being infected, rainbow trout RBCs could 2. Niels C. Bols, University of Waterloo, respond to IPNV with increased expression of antiviral genes. Fish Waterloo, Canada RBCs could be considered as mediators of the antiviral response and therefore targets of new strategies against fish viral infections. Any reports and responses or comments on the Further research is ongoing to completely understand the molecular article can be found at the end of the article. mechanism that triggers this antiviral response in rainbow trout RBCs. Keywords erythrocytes, IPNV, birnavirus, immune response, antiviral, trout, interferon   Page 1 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 Corresponding author: Maria del Mar Ortega-Villaizan ([email protected]) Author roles: Nombela I: Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing; Carrion A: Formal Analysis, Investigation; Puente-Marin S: Investigation; Chico V: Formal Analysis, Investigation, Writing – Review & Editing; Mercado L: Resources; Perez L: Writing – Review & Editing; Coll J: Writing – Review & Editing; Ortega-Villaizan MdM: Conceptualization, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests: No competing interests were disclosed. Grant information: This work was supported by the European Research Council (ERC starting grant 2014 GA639249). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2017 Nombela I et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). How to cite this article: Nombela I, Carrion A, Puente-Marin S et al. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective [version 2; peer review: 2 approved] F1000Research 2017, 6 :1968 https://doi.org/10.12688/f1000research.12994.2 First published: 07 Nov 2017, 6:1968 https://doi.org/10.12688/f1000research.12994.1   Page 2 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 and protein expression analysis. Finally, we evaluated the ability  R EV IS ED    Amendments from Version 1 of RBCs to confer protection against IPNV in CHSE-214 cells, which are susceptible to IPNV infection. To summarize, here In this new version of the manuscript we have included the corrections of Dr. Rimstad and Dr. Bols along the manuscript, we report the regulation of the immune response of rainbow in order to improve manuscript understanding. The line of the trout RBCs by IPNV, a non-infective virus in this cell type. This manuscript has not changed, but the manuscript comprehension immune response was characterized by the expression of genes has been improved. We have corrected several mistyping related to the IFN-1 pathway, Mx production and induction and linguistic errors, as well as clarifying some points in the manuscript and eliminating some confusing citations. Therefore, of an antiviral state to IPNV in CHSE-214 cells. some references have been eliminated and one reference previously unpublished is now updated. Besides, as Dr. Bols Methods suggested, in Figure 3A, FFU/ml has been removed from the y axis and only mentioned in the legend of the figure. Animals Rainbow trout (Oncorhynchus mykiss) individuals of See referee reports approximately 10 g were obtained from a commercial fish farm (PISZOLLA S.L., CIMBALLA FISH FARM, Zaragoza, Spain). Fish were maintained at the University Miguel Hernandez Introduction (UMH) facilities with a re-circulating dechlorinated-water sys- Fish viral infections cause significant losses in aquaculture. tem, at a stocking density of 1 fish/3L, at 14°C, and fed daily with Infectious pancreatic necrosis (IPN) is a highly contagious viral a commercial diet (SKRETTING, Burgos, Spain). Fish were disease with a high impact on salmonid aquaculture industry. acclimatized to laboratory conditions over 2 weeks before Infectious pancreatic necrosis virus (IPNV) is the causative agent experimentation. The number of fish used is indicated for each of IPN and was the first fish virus isolated in cell culture1. IPNV experiment/figure. outbreaks are usually related to high mortality rates in salmonid aquaculture, especially in young individuals2,3, highlight- RBCs purification ing the urgent necessity for the development of efficient strate- Rainbow trout were sacrificed by overexposure to tricaine gies in vaccination. IPNV belongs to the Aquabirnavirus genus methanesulfonate (Sigma-Aldrich, Madrid, Spain) at 0.2 g/L. within the Birnaviridae family. Viruses of this family are non- Peripheral blood was sampled from the caudal vein using insu- enveloped particles with a double stranded RNA genome. This lin syringes (NIPRO Bridgewater, NJ). Approximately 100 µL genome consists of two segments: the A segment contains the infor- of blood was diluted in RPMI-1640 medium (Dutch modifica- mation to encode a protein that is post-translationally cleaved into tion) (Gibco, Thermo Fischer Scientific Inc., Carlsbad, CA) VP2, VP3 and VP4 viral proteins; the B segment encodes the supplemented with 10% FBS (Cultek, Madrid, Spain), 1 mM pyru- viral RNA polymerase VP14. VP2 and VP3 are the major struc- vate (Gibco), 2 mM L-glutamine (Gibco), 50 µg/mL gentamicin tural and immunogenic proteins, as they represent 64% of the total (Gibco), 2 µg/mL fungizone (Gibco) and 100 U/mL penicillin/ proteins of the virion5. streptomycin (Sigma-Aldrich). Then, RBCs were purified by two consecutive density gradient centrifugations with Histopaque In contrast to mammals, fish, reptiles and avian red blood 1077 (7206g, Ficoll 1.007; Sigma-Aldrich). Finally, RBCs were cells (RBCs) are nucleated. Typically, the role associated with washed twice with RPMI 2% FBS. Purity of RBCs of 99.9% RBCs has been the transport of O to different tissues and gas 2 was estimated by optical microscopy evaluation. Then, purified exchange. However, a whole set of biological processes related RBCs were cultured in the above indicated medium at a density of to the immune response has been recently reported for nucle- 107 cells/mL, in cell culture flasks, at 14°C, overnight. ated RBCs from different species: recognition of pathogen associated molecular patterns6,7 through expression of pattern recognition receptors, such as toll-like receptors (TLRs)8; produc- Viral infection assays tion of cytokine-like factors7,9–11; phagocytosis12; and formation Ex vivo rainbow trout RBCs along with CHSE-214 cell line of complement immune complexes13. Fish RBCs are known to (Chinook Salmon Embryo, ATCC CRL-1681) were infected be the target of some viruses, such as infectious salmon anemia using IPNV Sp strain17. IPNV was grown as previously virus (ISAV)11 and piscine orthoreovirus (PRV)14,15. Furthermore, described18. Ex vivo RBCs exposure to IPNV was performed by both viruses can induce immune responses in infected RBCs, incubating RBCs with diluted IPNV at the indicated MOI (mul- characterized by the expression of genes related to IFN-1 (type I tiplicity of infection) in RPMI 2% FBS. After three hours of interferon) pathway. Besides, recently it has been shown that incubation at 14°C, RBCs were centrifuged at 1600 rpm for viral hemorrhagic septicemia virus (VHSV) halted replication in 5 minutes and then washed with medium to completely elimi- rainbow trout RBCs could induce cytokine production16. nate the non-adsorbed excess of virus. Finally, RBCs were placed in 24 well plates (Corning Costar, Sigma-Aldrich, Madrid, Spain) In view of the aforementioned evidence, this study was aimed with 500 µl of RPMI 2% FBS. The whole process was done at to evaluate the immune response of rainbow trout RBCs against 14°C. Infection of the CHSE-214 cell line was done by incu- IPNV, one of the most ubiquitous viral fish pathogens. To bating IPNV diluted in RPMI 2% FBS at the desired MOI for achieve this objective, we first analyzed the infectivity of IPNV 1 hour at 14°C. After that, medium was removed and RPMI 2% in rainbow trout RBCs. Then, RBCs immune response was evalu- FBS was added to each well. Infected CHSE-214 cells were ated after ex vivo exposure to IPNV, by means of antiviral gene maintained at 14°C18. Page 3 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 In time course experiments, the initial supernatant with IPNV IgG (H+L) CF™ 488 antibody produced in goat were used as was not removed. When each of the time points was reached, secondary antibodies for proteins and anti-mouse IgG (H+L) RBCs were washed with cell culture medium and CHSE-214 cells CF™ 647 produced in goat to detect 2F12 antibody. with PBS supplemented with calcium. For western blotting, rabbit polyclonal antibody against Viral titration assay human eIF2α-P (Cat# E2152, RRID:AB_259283) and rabbit The virus titer in IPNV-exposed RBCs supernatants was polyclonal antibody against human α-Actin (Cat#2066, RRID: quantified by TCID and by RT-qPCR. Briefly, different dilutions AB_476693) were purchased from Sigma-Aldrich. 50 of the supernatants (from 10-1 to 10-4) were added to CHSE-214 cell monolayers, and incubated at 14°C for 90 minutes. Then, Western blot the virus was removed and infected CHSE-214 cell monolay- Control and IPNV-exposed RBCs pellets (≈107 cells) were used ers covered with a solution of RPMI 2% FBS. Cell plates were for protein extraction. Cell pellets were washed 3 times with incubated at 14°C for 7 days. For RT-qPCR titration, 30 µL of PBS and then resuspended in 30 µl of PBS with a cocktail of IPNV with known titer (109 TCID /mL) and 30 µL of protease inhibitors (Sigma-Aldrich). Then, cells were frozen/ 50 IPNV-exposed RBCs supernatants were used to extract RNA thawed 3 times and lysed using an eppendorf micropistile and synthetize cDNA, as explained hereafter. Ten-fold serial (Eppendorf, Hamburg, Germany). Samples were loaded in Tris– dilutions from 108 to 102 TCID /mL were done to obtain IPNV Glycine sodium dodecyl sulfate 12% polyacrylamide gels under 50 cDNA and create a standard line. reducing conditions. Electrophoresis was performed at 200 V for 60 min. For blotting, the proteins in the gel were transferred RNA isolation and DNAse treatment for 80 min at 100 V in transfer buffer (2.5 mM Tris, 9 mM glycine, The E.Z.N.A.® Total RNA Kit (Omega Bio-Tek Inc., Norcross, 20% methanol) to nitrocellulose membranes (BioRad, Madrid, GA) was used for total RNA extraction, in accordance with Spain). Then, membranes were blocked with 8% dry milk and manufacturer’s instructions. DNAse treatment was done in 1% Tween-20 in PBS and incubated with eIF2α-P or α-Actin order to eliminate residual genomic DNA using TURBO™ antibodies, at the recommended dilutions in PBS containing DNase (Ambion, Thermo Fischer Scientific Inc.), following the 0.5% dry milk and 0.5% Tween-20 at 4°C and overnight. Incuba- manufacturer’s instructions. RNA was quantified with a tion with secondary antibody GAR-Po (Sigma-Aldrich) was done NanoDrop® 377 Spectrophotometer (Nanodrop Technologies, in 0.5% milk 0.5% Tween-20 in PBS for 45 min. Membranes Wilmington, DE). were washed 3 times with PBS containing 1% dry milk 0.5% Tween-20 for 15 min after every antibody incubation. Finally, Gene expression by RT-qPCR the membrane was washed 3 times with PBS before analysis of cDNA was synthesized from RNA using M-MLV reverse tran- the peroxidase activity. Peroxidase activity was detected using scriptase (Invitrogen, Thermo Fischer Scientific Inc.), as previ- ECL chemiluminescence reagents (Amersham Biosciences, ously described19. Final concentration of cDNA was 6 ng/µL. Buckinghamshire, UK) and revealed by exposure to X-ray. RT-qPCR reactions were performed in a total volume of 20 µl Protein bands from western blotting were analysed by densitometry using 12 ng of cDNA, 10 µl of TaqMan universal PCR mas- using the Scion Image 4.0.2 Software (RRID: SCR_008673) ter mix (Thermo Fischer Scientific), 900 nM final concentration (www.scionorg.com). of each primer (300 nM for IPNV segment A) and 300 nM of probe (150 nM for IPNV segment A). RT-qPCR was performed Intracellular immunofluorescence stain and flow cytometry using the ABI PRISM 7300 System (Thermo Fischer Scientific). RBCs were fixed with 4% paraformaldehyde (PFA; Sigma- Cycling conditions were 50°C for 2 min and 95°C for 10 min, Aldrich) and 0.08% glutaraldehyde (Sigma-Aldrich) diluted in followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. RPMI medium for 20 minutes. Then, RBCs were incubated with permeabilization buffer containing 0.05% saponin (Sigma-Aldrich) Gene expression was analyzed by the 2-ΔΔCt method20. The in RPMI, for 15 minutes. Primary antibodies were used at 1/50 eukaryotic 18S rRNA gene (Cat#4310893E, Thermo Fischer dilution for IL-1β, IL-8 and TNF-α, 1/300 for Mx and 1/500 Scientific) was used as endogenous control. Primers and probes are for 2F12 in permeabilization buffer and incubated for 60 minutes listed in Table 1. at room temperature. Secondary antibodies were incubated for 30 minutes at 1/200 dilution. RBCs were washed with per- Antibodies meabilization buffer after antibody incubations. Finally, RBCs Several antibodies were used to stain cells for cytokines and were kept in PFA 1% in PBS. For nuclear staining, RBCs were to measure polypeptides in RBCs extracts by western blotting. stained with 1 µg/mL of 4′-6-408 Diamidino-2-phenylindole They are briefly described below and their Research Resource (DAPI; Sigma-Aldrich) for 5 minutes. Flow cytometry (FC) Identifiers (RRIDs) given. For intracellular staining, analysis was done in a BD FACSCanto™ II (BD Biosciences) mouse polyclonal antibodies against rainbow trout IL1β (RRID: flow cytometer. Immunofluorescence (IF) images were performed AB_2716269)21,22, IL8 (RRID: AB_2716272)23 and TNF-α (RRID: in the INCell Analyzer 6000 Cell imaging system (GE Healthcare, AB_2716270)24 were produced at the laboratory of Dr. Luis Little Chalfont, UK). Mercado. Rabbit polyclonal antibody against rainbow trout Mx3 (RRID: ABA_2716267)25,26 was produced at the laboratory of Antiviral activity of conditioned medium Dr. Amparo Estepa. Anti-IPNV-VP3 monoclonal antibody 2F12 Conditioned medium (CM) was obtained from control (RRID: AB_2716296) was used for IPNV labelling27. Anti-rabbit and IPNV-exposed RBCs at MOI 0.5, during 3 days. The IgG (H+L) CF™ 488 antibody produced in goat and anti-mouse CMs were clarified at 1600 rpm for 5 min. IPNV titer in the Page 4 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 1 1 Reference or accession number 18 M_001124578. AJ829673 AM489418.1 28 M_001145891. 29 30 31 N N T A Probe (5’ – 3‘) GAACCAGGTGACGAGTATGAGGACTAC CAAGTTGTCCCGCTGTCTGCTCCTG TCGAGCCAAACACCAGCCCCT AATGCCCCAGTCCTTTTCCCAAATC CCTCATCAGCCTAGAGATTGGCTCCCC ACCACCTCTGAGAGCGACACCACTTC A A C C C GT TT T e primer – 3‘) GATGGGTTGTT ATTTGGACGAA ACCCGTCAGT AGCATCATCTAT GATGAGTGTGA GCTGCCTGAAT TTGTTGTTGGC CCCTTGACATAT GGATGGCTGCT Revers(5’  CGGTTTCAC GAGGAGGCA GGTCTGGCA CCTCAAACTC TGGCAGGTC GGACGAACT CCCTCTTCAT CTGAATTTTC CCCTCTAAAT T C A G T A C of primers and probes. Forward primer (5’ – 3‘) TCTCCCGGGCAGTTCAAGT ACTCGGTGGTGCTGGTCTTC CCCAGGGTTCAGCTCCACTA ACCAGATGGGAGGAGATATCACA TGAAGCCCAGGATGAAATGG GACACCGCGTACCGATGTG AGAGACACTGAGATCATTGCCAC AAACTGAAAGTCCACTATAAGATCTC AGCATGGAAGACCGTCAACGAT st  C Li able 1.  Gene IPNV SA tlr3 irf7 ifn1 mx1–3 pkr il8 ifn γ tnf α T Page 5 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 supernatants of IPNV-exposed RBCs resulted in 10 TCID /mL for animals used in research experimentation. All experimen- 50 or less, therefore viral presence in the supernatants was obviated. tal protocols involving animal handling were also reviewed and To test the antiviral activity of the CM, confluent CHSE-214 cells approved by the Animal Welfare Body and the Research (7.8×104 cells/well), seeded in 96 well plates, were pre-treated Ethics Committee at the Miguel Hernandez University (approval with 100 µL of each supernatant at the indicated dilutions for number 2014.205.E.OEP; 2016.221.E.OEP) and performed 24 hours. After that, CHSE-214 cells were infected, as described by qualified research personnel. previously, with IPNV at MOI 0.05, for 24 hours. Finally, intracellular staining of IPNV foci was carried out. Results IPNV did not infect rainbow trout RBCs Intracellular staining of IPNV foci To evaluate the infectivity of IPNV in rainbow trout RBCs, CHSE-214 cells were fixed with PFA diluted at 4% in PBS RBCs were exposed to IPNV at MOI 0.5 and the viral RNA followed by a second fixation with cold methanol. Each was evaluated by RT-qPCR in the cell pellet at different times fixation step lasted 15 minutes. Cells were washed with PBS post-exposure. IPNV infectivity was also evaluated in after each fixation step. Blocking buffer containing 5% goat parallel in the CHSE-214 cell line, used as a positive control serum (Sigma-Aldrich) and 0.3% Triton X-100 (Sigma-Aldrich) of infection. IPNV segment A (IPNV-A) RNA levels inside was added to each well with the cells for 1 hour. Then, anti-VP3 RBCs and CHSE-214 cell line were similar at 1 and 3 hours 2F12 antibody was diluted 1/500 in antibody dilution buffer post-exposure (hpe) (Figure 1A). After 6 hpe, IPNV-A RNA level (1% BSA (Sigma-Aldrich), 0.3% Triton X-100) and was incu- was 3 logarithms lower in RBCs in comparison with CHSE-214 bated for 1 hour. FITC-labelled goat anti-rabbit was used as sec- cells. On the other hand, the titer of IPNV in the supernatants ondary antibody at 1/300 dilution. Cells were washed three times from IPNV-exposed RBCs at a MOI of 0.5 and 5, was evalu- after each antibody incubation with PBS. IF images were ated by TCID , at 3 days post-exposure (dpe), and showed a 50 taken INCell Analyzer 6000 imaging system. IN Cell Devel- recovered titer of 5 and 4 logarithms lower, respectively oper Toolbox 1.9.2 (RRID: SCR_015790; GE Healthcare, Little (Figure 1B). Furthermore, the supernatants titrated by RT-qPCR, Chalfont, UK) was used to count number of IPNV foci were below the lowest limit of detection 102 TCID (Table 2). 50 (positive areas after image segmentation were selected when Moreover, FC analysis of control and IPNV-exposed RBCs >21000 fluorescence units and >2500 µm2 criteria was reached). for IPNV VP3 protein did not show significant differences (Figure 1C and D). Therefore, IPNV did not infect rainbow trout MTT assays RBCs. Cell viability was tested using MTT (3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyltetrazolium bromide) colorimetric assay32. Briefly, IPNV exposure increased the expression of interferon- 25 µl of MTT at a final concentration of 1.9 mg/mL were added related antiviral genes and proteins in rainbow trout RBCs to previously treated CHSE-214 cells monolayers, seeded in To determine if IPNV would induce an antiviral response 96 well plates. Cells were incubated for 3 hours at 21°C with the in RBCs, RT-qPCR analysis of IFN-related antiviral genes was reagent. Then, the medium was removed from the wells. Formazan performed for IPNV-exposed RBCs. The results showed that crystals were dissolved in 100 µl of 100% DMSO, incubated for mx1–3 and pkr genes were significantly expressed at 72 hpe. On 30 minutes. Absorbance was read at 570 nm in the EONTM the other hand, ifn1 gene presented a tendency to increase its microplate spectrophotometer (Biotek, Winooski, VT). Percent- expression after 6 hpe, having a peak at 24 hpe. Also, tlr3 gene age of viable cells was calculated as follows: absorbance treated expression tended to be upregulated at 24 hpe, whereas irf7 cells/absorbance non-treated cells) x100. expression was upregulated at 72 hpe (Figure 2A). Three and six dpe with IPNV, RBCs were stained intracellularly with an anti-Mx Software and statistics antibody and analyzed by FC and immunofluorescence imaging All the figures and graphics show the mean and standard devia- (IF). The results showed a significant increment in the expres- tion of the data. P-values associated with each graphic are repre- sion of Mx protein at 6 dpe by both FC an IF (Figure 2B and D). sented by the legends: *, p-value < 0.05; **, p-value < 0.01; ***, FC histograms showed, at 6 dpe, that RBCs depicted distinct p-value < 0.001, ****, p-value < 0.0001. Graphpad Prism 6 peaks of Mx expression, showing that the expression of Mx in (RRID: SCR_002798, www.graphpad.com) (Graphpad RBCs was heterogeneous in the total RBCs population Software Inc., San Diego, A) was used for preparing graphs (Figure 2C). and preforming statistical calculations. FC data were analyzed using Flowing Software 2.5.1 (RRID: SCR_015781)(www.flow- Conditioned medium from IPNV-exposed RBCs protected ingsoftware.com) to obtain Mean Fluorescence Intensity (MFI) and CHSE-214 cells against IPNV infection Mean Relative Fluorescence Intensity (MRFI) (relative to control To analyze if IPNV-exposed RBCs could secrete factors cells) values. that were capable to protect other fish cells against IPNV infec- tion, conditioned medium (CM) from control and IPNV-exposed Ethics approval RBCs (with IPNV titer <10 TCID /mL) were added to CHSE- 50 Methodology was carried out in accordance with the 214 cells prior to infection. Figure 3A shows a significant Spanish Royal Decree RD 53/2013 and EU Directive 2010/63/EU decrease in the number of IPNV infective focus forming units Page 6 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 Figure 1. Infectivity of IPNV in RBCs. (A) Time-course experiment of the expression of IPNV segment A (IPNV-A) in RBCs (●) (n = 6) and CHSE-214 cells ( ) (n = 2) at MOI 0.5. Data is represented as mean±SD. Kruskal-Wallis Test with Dunn´s Multiple Comparison post-hoc test was performed among all time-points post-exposure in comparison with control time point (0 hpi) (*, p-value < 0.05). (B) Recovered virus titer in supernatants from IPNV-exposed RBCs with an inoculum titer of 106 (MOI 0.5) and 107 (MOI 5) TCID /mL obtained after 50 72 hpe (n = 5). Data is represented as mean±SD. Mann-Whitney test was performed among both conditions (*, p-value < 0.05). (C) MFI (mean fluorescence intensity) of viral protein VP3 in control and IPNV-exposed RBCs at MOI 0.5 and 3 dpe (n = 6) Mann-Whitney test was performed among both conditions. (D) Representative flow cytometry histograms of IPNV VP3 protein detection in control and IPNV-exposed RBCs at MOI 0.5 and 3 dpi. Table 2. Rt-qPCR virus titration.  Sample Ct value ± SD Ct value ± standard deviation from RBCs #2 3 dpe Undetected standard line points (108 to 102 dilutions) and supernatants from RBCs #2 6 dpe Undetected IPNV-exposed RBCs at MOI 0.5, at 3 and 6 dpe. (n=7 individuals). RBCs #3 3 dpe Undetected RBCs #3 6 dpe Undetected Sample Ct value ± SD RBCs #4 3 dpe Undetected 108 TCID 25,885 ± 0,052 50 RBCs #4 6 dpe Undetected 107 TCID 29,856 ± 0,117 50 106 TCID 33,165 ± 0,168 RBCs #5 3 dpe Undetected 50 105 TCID 36,057 ± 0,11 RBCs #5 6 dpe Undetected 50 104 TCID 39,126 ± 0.873 RBCs #6 3 dpe Undetected 50 103 TCID Undetected RBCs #6 6 dpe Undetected 50 102 TCID Undetected RBCs #7 3 dpe Undetected 50 RBCs #1 3 dpe Undetected RBCs #7 6 dpe Undetected RBCs #1 6 dpe Undetected NTC Undetected Page 7 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 Figure 2. RBCs IFN-related antiviral response against IPNV. (A) Gene expression of tlr3, irf7, inf1, mx1–3 and pkr in IPNV-exposed RBCs at the indicated times post-infection and MOI 0.5, measured by RT-qPCR. Data represent mean±SD (n = 6). Kruskal-Wallis Test with Dunn´s Multiple Comparison post-hoc test was performed among all time-points post-exposure in comparison with control time point (0 hpi) (*, p-value < 0.05). (B) Mx protein MRFI (mean relative fluorescent intensity, relative to control cells) in IPNV-exposed RBCs at MOI 0.5 (n = 5). (C) Flow cytometry histograms of Mx protein expression from control (grey) and IPNV-exposed (red) RBCs at MOI 0.5 and the indicated days post-exposure (dpe). (D) Representative immunofluorescence images of Mx protein expression in control and IPNV-exposed RBCs at MOI 0.5 (FITC – Mx protein expression, DAPI - Nuclei) (IF representative of 40 images). Figure 3. Antiviral activity of the conditioned media from IPNV-exposed RBCs. (A) Viral titers (FFU/mL) in CHSE-214 cells infected with IPNV at MOI 0.05 previously non-treated (black) or treated with either supernatants from control RBCs (white) or IPNV- exposed RBCs (grey), during 24 hours, at the indicated dilutions (n = 4, performing triplicates from each individual). Two-way ANOVA, with Sidak´s multiple comparison test, was performed among the different dilutions and conditions to test statistical differences. (B) Percentage of viable CHSE-214 cells pre-treated with conditioned medium from control and IPNV-exposed RBCs, during 24 hours, and relative to non-treated CHSE-214 cells. Percentage of viable cells was calculated as follows: absorbance treated cells/absorbance non-treated cells) x100. Page 8 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 (FFU/mL) when pre-treating with 1/5 diluted CM from of the evaluated cytokines protein levels, we further investi- IPNV-exposed RBCs. CHSE-214 cells viability, by means of gated whether IPNV exposure could reduce protein translation in an MTT colorimetric assay, was not affected by the exposure to RBCs by triggering the phosphorylation of eIF2α. However, CM (Figure 3B). the results revealed no changes in the phosphorylation of eIF2α (Figure 4B). IPNV exposure decreased the expression of cytokines in rainbow trout RBCs Dataset 1. Excel file containing qPCR data To evaluate whether ex vivo rainbow trout RBCs could http://dx.doi.org/10.5256/f1000research.12994.d182842 produce cytokines in response to IPNV exposure, RBCs were Each sheet contains the raw Ct values for the indicated figure exposed to IPNV and IL-1 β, IL-8 and TNF-α protein levels numbers, organized by samples (rows) and genes (columns). were evaluated by means of FC and IF in control and IPNV- exposed cell cultures. The results showed a decrease in the protein expression of IL-1β, IL-8 and TNFα in IPNV-exposed RBCs Dataset 2. Excel file containing the virus titration data (Figure 4A). http://dx.doi.org/10.5256/f1000research.12994.d182843 Contains the virus titer (TCID /mL) results of the indicated figure 50 IPNV exposure did not induce phosphorylation of the number. α-subunit of the eukaryotic translational initiation factor 2 (eIF2α) in rainbow trout RBCs Dataset 3. Flow cytometry data The phosphorylation of the translation initiation factor http://dx.doi.org/10.5256/f1000research.12994.d182844 eIF2α is a key mechanism of global inhibition of translational initiation33 and it has been described to happen after IPNV Each folder contains the Flow Cytometry Standard (.fcs) format infection in the permissive cell line CHSE-214 cells34. In this files. Source data files are organized by figure number, and then by sample number, condition and antibody. sense, since IPNV-exposed RBCs depicted a small downregulation Figure 4. IPNV-exposure decreased cytokine levels in rainbow trout RBCs. (A) Intracellular MFI (mean fluorescent intensity) values of IL-1β, IL-8 and TNFα from control and IPNV-exposed RBCs at MOI 0.5 and 3 dpe measured by FC (flow cytometry)(n = 6). Mann-Whitney test was performed among both conditions. (B) Phosphorylation of translation initiation factor eIF2α in IPNV-exposed RBCs. Representative western blot of eIF2α-P in control and IPNV-exposed RBCs from two individuals at MOI 0.5, 3 dpe. Densitometry ratios were done relativizing to α-actin. Mann-Whitney test was performed among both conditions. Page 9 of 27 F1000Research 2017, 6:1968 Last updated: 30 MAR 2022 Previously, a positive correlation between the expression of Dataset 4. Excel file containing the Focus Forming Units (FFU)  counting for Figure 3A Mx protein and the inhibition of IPNV in CHSE-214 cells has been established39. Therefore, Mx protein production in http://dx.doi.org/10.5256/f1000research.12994.d182845 IPNV-exposed RBCs could be involved in the low IPNV titers observed. The high basal levels of Mx protein detected inside Dataset 5. Excel file containing MTT absorbance raw data RBCs (Figure 2D), much elevated than those for CHSE-214 cells http://dx.doi.org/10.5256/f1000research.12994.d182846 (Figure S1), could be implicated in the early disappearance of IPNV inside RBCs. A similar hypothesis has been made in the abortive infection of VHSV in the RTS-11 cell line40 and in Dataset 6. Excel file containing the densitometry raw data of  eIF2α-P and α-Actin western blots rainbow trout RBCs16, where upregulation or high constitu- tive expression of mx genes was speculated to be related to the http://dx.doi.org/10.5256/f1000research.12994.d182847 inhibition of the virus. Related uncropped blots are included. Moreover, our results showed that CM from RBCs Discussion exposed to IPNV could partially protect CHSE-214 cells from Previously, we have demonstrated that rainbow trout IPNV infection. Similar to other cell types, this antiviral activ- RBCs can respond to VHSV, a ssRNA virus not targeting ity has been also observed in CM of RTS11 and RTG-2 cells RBCs, halting its replication, downregulating type I interferon- exposed to Poly (I:C) (polyinosinic:polycytidylic acid) and/or related genes, showing global protein downregulation in the infected with chum salmon reovirus41. The fact that RBCs can cell and phosphorylation of the translation initiation factor secrete factors that confer protection against IPNV infection in eIF2α16. other cell lines could indicate that RBCs, despite not being per- missive to IPNV infection, may exhibit an antiviral response. It is known that IPNV primarily targets pancreatic and liver Besides, we evaluated the production of cytokines in IPNV- cells35. It has been also reported that IPNV was detectable in exposed RBCs. Previously, the expression of IL-1β in salmon kidney hematopoietic tissue, corpuscles of Stannius, in Islets of gill and head kidney tissues42, IL-8 in rainbow trout head kidney Langherhans, in the lamina propria of the pyloric caeca, the gill tissue43 and TNFα in zebrafish embryonic cells44 have been arch connective tissue, the ventricle of the heart and dermis of implicated in the immune response against IPNV; therefore, the skin35. Our results showed that IPNV did not replicate in we chose these cytokines to evaluate the immune response RBCs, although small amounts of IPNV were persistently found of rainbow trout RBCs to IPNV exposure. However, our results inside RBCs after 3 dpe (≈ 103 TCID /mL). Similarly, IPNV showed a reduction trend of these proteins in IPNV-exposed 50 has been shown to enter mammalian cells, without significant RBCs. levels of replication, being this entry suggested to be receptor mediated36. From our results, the persistence of IPNV in RBCs A shutdown in protein synthesis by phosphorylation of after 72 hpe could point out the entry of the virus inside RBCs. eIF2α has been reported in CHSE-214 cells infected with IPNV34. However, we could not further verify the presence of the So far, in rainbow trout RBCs exposed to IPNV, although a trend IPNV inside RBCs (Figure 1). to cytokine protein reduction was observed, no phosphorylation of eIF2α was detected and Mx protein expression was increased. Nevertheless, despite the lack of replication of IPNV in IFN-1 has been reported to inhibit the production of IL-1β45, RBCs, IPNV could induce an antiviral gene expression mediated therefore, the cytokine reduction trend observed could have been by the IFN pathway, as it has been observed in RBCs produc- a result of the related IFN-1 pathway upregulation. In tive infections with ISAV11 and PRV14. As shown by our results, contrast, in rainbow trout RBCs, VHSV rhabdovirus induced ifn1 and IFN-1 related genes (irf7, pkr and mx) expression levels phosphorylation of eIF2α and a cell shut-off characterized by were increased time-dependently in response to IPNV-exposure. the downregulation of the proteome16. High inter-individual variability was observed, similarly to that found in the RBCs from salmons challenged with PRV37. In Further studies are needed to completely understand the addition, although we could not verify the entry and uncoating molecular mechanism through which IPNV triggers this of IPNV inside RBCs, we could observe an increment in the immune response in rainbow trout RBCs. However, the lack of expression of the tlr3 gene in parallel to the expression of commercial antibodies against fish proteins involved in cell sig- the other IFN-related genes in IPNV-exposed RBCs. This naling networks limits the study of this area. The implication could indicate the activation of the TLR3/IFN pathway by the of RBCs during in vivo IPNV infection and the response presence of intracellular viral dsRNA. against different strains of IPNV remains to be evaluated. IFN-1 leads to the expression of interferon stimulated genes (ISGs)38. Among ISGs, the antiviral protein Mx has a well Finally, one of the potential applications of these results characterized antiviral role. Confirming those expectations, is that fish RBCs could be considered mediators of the antivi- our results showed the significant upregulation of the Mx pro- ral response and therefore targets of novel DNA vaccines and tein 6 dpe, after having a peak of its gene expression at 3 dpe. of new strategies against fish viral infections. Page 10 of 27