MCP Papers in Press. Published on March 26, 2015 as Manuscript M114.047571 Immunocapture-selected reaction monitoring screening facilitates the development of ELISA for the measurement of native TEX101 in biological fluids Dimitrios Korbakis1,2*, Davor Brinc3*, Christina Schiza1,3*, Antoninus Soosaipillai3, Keith Jarvi4,5, Andrei P. Drabovich1,2, Eleftherios P. Diamandis1,2,3,4 1Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Canada; 2Department of Clinical Biochemistry, University Health Network, Toronto, Canada; D o 3Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, Canada; wn lo a d e 4Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada d fro m h 5Department of Surgery, Division of Urology, Mount Sinai Hospital, University of Toronto, Canada ttp ://w w w .m c p o n *these authors contributed equally to this work lin e .o rg by/ g u e s Running title: Immunocapture-SRM screening for TEX101 ELISA development t o n A p ril 6 , 2 0 1 9 Correspondence should be addressed to: E.P. Diamandis, Ph.D., M.D. Mount Sinai Hospital, Joseph & Wolf Lebovic Ctr., 60 Murray St [Box 32]; Flr 6 - Rm L6-201 Toronto, ON, M5T 3L9, Canada Tel: 416-586-8443; Fax: 416-619-5521; e-mail: [email protected] Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc. OR A.P. Drabovich, Ph.D. Department of Laboratory Medicine and Pathobiology, University of Toronto, 60 Murray St [Box 32]; Flr 6 - Rm L6-201 Toronto, ON, M5T 3L9, Canada Tel: (416) 586-4800 ext. 8805; Fax: 416-619-5521; e-mail: [email protected] D o w n lo a d e d fro m h ttp ://w w w .m c p o n lin e .o rg by/ g u e s t o n A p ril 6 , 2 0 1 9 2 Summary Monoclonal antibodies that bind the native conformation of proteins are indispensable reagents for the development of immunoassays, production of therapeutic antibodies and delineating protein interaction networks by affinity purification-mass spectrometry. Antibodies generated against short peptides, protein fragments or even full length recombinant proteins may not bind the native protein form in biological fluids, thus limiting their utility. Here, we report the application of immunocapture coupled with Selected Reaction Monitoring (SRM) measurements, in the rapid screening of hybridoma culture supernatants for monoclonal antibodies that bind the native protein conformation. We produced mouse D o w monoclonal antibodies, which detect in human serum or seminal plasma the native form of the human nlo a d e d testis-expressed sequence 101 (TEX101) protein – a recently proposed biomarker of male infertility. fro m h ttp Pairing of two monoclonal antibodies against unique TEX101 epitopes led to the development of an ://w w w ELISA for the measurement of TEX101 in seminal plasma (Limit of Detection – LOD: 20 pg/mL) and .m c p o n lin serum (LOD: 40 pg/mL). Measurements of matched seminal plasma samples, obtained from men pre- e .o rg b/ and post-vasectomy, confirmed the absolute diagnostic specificity and sensitivity of TEX101 for non- y g u e s t o invasive identification of physical obstructions in the male reproductive tract. Measurement of male and n A p ril 6 female serum samples revealed undetectable levels of TEX101 in the systemic circulation of healthy , 2 0 1 9 individuals. Immunocapture-SRM screening may facilitate development of monoclonal antibodies and immunoassays against native forms of challenging protein targets. 3 Keywords: TEX101; testis-expressed sequence 101 protein; selected reaction monitoring; mass spectrometry; proteomics; native protein conformation; ELISA; seminal plasma; male infertility Non-standard abbreviations: ABC, Ammonium bicarbonate; BCA, Bicinchoninic acid; BMGY, Buffered complex glycerol medium; BMMY, Buffered complex methanol; DFP, Diflunisal phosphate; DOC, Deoxycholate; DTT, Dithiothreitol; ELISA, Enzyme-linked immunosorbent assay; FWHM, Full width at half maximum; D o w GPI, glycosylphosphatidylinositol ; Fc, constant region of immunoglobulin; HAT, Hypoxanthine- n lo a d e d aminopterin-thymidine medium; HRP, Horseradish peroxidase; KLK, Kallkrein; MS, Mass fro m h spectrometry; mAb, monoclonal antibody; NOA, Non-obstructive azoospermia; OA, Obstructive ttp ://w w w azoospermia; PBS, Phosphate-buffered saline; PSA, Prostate-specific antigen; PV, Post-vasectomy; .m c p o n SRM, Selected reaction monitoring; SP, seminal plasma; TBS, Tris-buffered saline. lin e .o rg by/ g u e s t o n A p ril 6 , 2 0 1 9 4 Introduction Monoclonal antibodies that bind the native form of a protein are indispensable for the development of sensitive immunoassays, production of therapeutic antibodies and for studying protein interaction networks by affinity purification-mass spectrometry (1, 2). Large-scale purification of native proteins from biological samples may be challenging, so recombinant proteins or protein fragments are often used for antibody production. Antibodies produced against short peptides, protein fragments or even full length recombinant proteins, however, may not bind the native protein conformation present in biological fluids, thus limiting the utility of antibodies. Rapid screening of antibody-producing D o w hybridoma clones for native protein binders requires highly specific and sensitive assays, performed nlo a d e d under non-denaturing conditions. Here, we report the capability of an immunocapture-SRM assay to fro m h ttp facilitate fast screening of hybridoma cultures for monoclonal antibodies that recognize the native ://w w w conformation of TEX101 protein in biological fluids. .m c p o n lin Recently, we discovered, verified and validated two proteins, testis-specific protein TEX101 and e .o rg b/ epididymis-specific protein ECM1, as biomarkers for the differential diagnosis of azoospermia (3, 4). y g u e s t o Combination of TEX101 and ECM1 proteins measured in seminal plasma could differentiate between n A p ril 6 normal spermatogenesis, obstructive azoospermia (OA) and non-obstructive azoospermia (NOA) with , 2 0 1 9 very high diagnostic sensitivity and specificity. TEX101 levels in seminal plasma also facilitated classification of NOA subtypes of hypospermatogenesis, maturation arrest and Sertoli cell-only syndrome (5). A clinical laboratory test for TEX101 in seminal plasma may confirm the success of vasectomy or vasovasostomy, eliminate diagnostic testicular biopsies and predict the success of sperm cell retrieval for assisted reproduction. Human TEX101 is a membrane GPI-anchored protein encoded by the TEX101 gene, located in the 19q13.31 region of chromosome 19. According to the Human Protein Atlas, TEX101 expression is 5 restricted to testicular tissue and male germ cells, with no evidence of expression in any other human tissue or cell type (6). Investigation of the function of mouse TEX101 demonstrated its direct role in fertilization (7-9). We initially measured TEX101 levels in seminal plasma by mass spectrometry-based SRM and immuno-SRM assays, with limits of detection of 120 and 5 ng/mL, respectively (4, 5). However, due to the ultra-wide range of TEX101 concentrations in seminal plasma of infertile and healthy men (0.5 ng/mL to 50,000 ng/mL) and theoretically zero levels for some azoospermic patients, a sensitive TEX101 immunoassay is required to develop a clinical laboratory test. In addition to immunoassay, D o w monoclonal antibodies against native TEX101 would allow investigating its interactome and revealing n lo a d e d its functional role in spermatogenesis and male fertility. Since TEX101 may emerge as a novel fro m h biomarker of male infertility, in this work we focused on the development of an ELISA for sensitive ttp ://w w w measurement of TEX101 in seminal plasma and serum. .m c p o n Our initial efforts to develop a TEX101 immunoassay using commercially available polyclonal lin e .o rg antibodies were not successful. We found that commercial antibodies recognized only the denatured by/ g u e s form of TEX101 and were useful for immunohistochemistry and Western blots, but not for the analysis t o n A p of native TEX101 in seminal plasma. Here, we describe the production of mouse monoclonal antibodies ril 6 , 2 0 1 9 against native TEX101, screening of antibody-producing clones by the two-step immunocapture and SRM assay, development of a sensitive ELISA and measurement of TEX101 in seminal plasma and serum (Figure 1). 6 Experimental Procedures Cloning of TEX101 cDNA into the yeast expression vector A commercial Pichia Expression Kit (Invitrogen, Waltham, MA) was used for production of recombinant TEX101. Based on the published TEX101 cDNA sequence (transcript variant 2, NM_001130011.1), a set of oligonucleotide primers (forward 5’- GAAGAAGGGGTATCTCTCGAGAAAGACTGTATTGTCAAAAGGGTCTGTCCAT-3’ and reverse 5’-TAGGGAATTCTTAATGGTGATGGTGATGATGATTTTCAGTCTTTCGAGGTTGA-3’) were designed for PCR amplification of the fragment coding for the mature form of TEX101 present in D o w seminal plasma (aa 26-222). Primers facilitated the generation of compatible restriction ends for ligation nlo a d e d into the pPIC9 vector, as well as the incorporation of a C-terminus polyhistidine tag for protein fro m h ttp purification (Supplementary Figure S1). TEX101 human cDNA ORF Clone (RC225319; Origene, ://w w w Rockville, MD) was used as a template. PCR was performed in a 20 μL reaction mixture, supplemented .m c p o n lin with 0.4 μL of cDNA (5 ng/μL final concentration), 4 μL of 5x Phusion GC Buffer, which contained 7.5 e .o rg b/ mM MgCl2, and provided 1.5 mM MgCl2 in the final reaction, 200 μM deoxynucleoside triphosphates, y gu e s t o 250 nM of the primers and 0.4 U of Phusion High-Fidelity DNA polymerase (New England BioLabs, n A p Ipswich, MA) on an Eppendorf Mastercycler thermal cycler. The PCR conditions were 98oC for 30 s, ril 6, 2 0 1 9 followed by 26 cycles of 98oC for 10 s, 68oC for 20 s, and 72oC for 20 s, with a final extension at 72oC for 7 min. In-frame cloning of the PCR product into the yeast expression vector pPIC9 was accomplished through double digestion, using XhoI and EcoRI restriction enzymes, and ligation of the two DNA fragments (Supplementary Figure S1). The sequence of the construct was confirmed by DNA sequencing. 7 Production of human TEX101 Prior to transformation of yeast cells, pPIC9 vector containing the TEX101 cDNA was linearized with SacI restriction enzyme to favor the integration of the construct in P. pastoris genome via homologous recombination. The linearized construct was introduced into the yeast strains GS115 and KM71 by electroporation. A stable clone was selected from the GS115 strain according to the manufacturer’s recommendations (Invitrogen). Stable yeast clones were grown in the buffered complex glycerol medium until the culture reached log-phase (OD =2-6). Following that, the cell pellet was resuspended 600 in the buffered complex methanol (BMMY) to an OD of 1.0 and was grown at 30oC with shaking. 600 D o w TEX101 production was induced with 10 mL/L methanol over 4 days. Yeast culture containing secreted n lo a d e d TEX101 was centrifuged and the supernatant was concentrated 100-fold initially by positive pressure fro m h ultrafiltration in an AmiconTM stirring chamber (Millipore, Billerica, MA) with a 10-kDa cutoff ttp ://w w w regenerated cellulose membrane (Millipore), followed by AmiconTM centrifugal filter tubes Ultracel 3K .m c p o n (Millipore). A rabbit polyclonal anti-TEX101 antibody HPA041915 (Sigma-Aldrich, St. Louis, MO) and lin e .o rg a mouse monoclonal anti- His antibody (Cat# A00186-100, GenScript, Piscataway, NJ) were used to by/ g u e s monitor TEX101 production by Western blot analysis. t o n A p ril 6 , 2 0 1 9 Purification of human TEX101 with immobilized metal ion affinity chromatography The recombinant TEX101 was purified from yeast culture supernatants by immobilized metal ion affinity chromatography. HIS-Select Nickel Affinity gel (Sigma-Aldrich) selective for recombinant proteins with histidine tags was used to purify TEX101 from yeast culture according to the manufacturer’s recommendations. In summary, the nickel affinity gel was first washed with 1-2 volumes of de-ionized water to remove ethanol, and then equilibrated with 3-5 volumes of equilibration buffer (10 mM imidazole in 50 mM NaH PO , 0.3 M NaCl, pH 8.0). Prior to application on the affinity gel, the 2 4 8 recombinant protein sample was clarified by centrifugation to obtain a pH between 7.0 and 8.0. Recombinant protein solution was incubated with affinity gel, which was subsequently washed with equilibration buffer. TEX101 was eluted with 250 mM imidazole in 50 mM NaH PO , 0.3 M NaCl, pH 2 4 8.0 at room temperature. The presence of TEX101 in various fractions was determined with Western blotting by using rabbit polyclonal anti-TEX101 antibody HPA041915 (Sigma-Aldrich). The purity and the molecular mass of TEX101 were determined by SDS-PAGE stained with Coomassie Blue. The purified TEX101 protein concentration was determined by the bicinchoninic acid assay (Pierce Biotechnology, Rockford, IL). D o w n lo a d e d Analysis of human recombinant TEX101 by mass spectrometry fro m h Following SDS-PAGE analysis, all visible gel bands were excised and analyzed by LC-MS/MS. An in- ttp ://w w w gel digestion protocol was followed, as described elsewhere (10). In all cases, peptides were extracted .m c p o n from solution using C18 OMIX tips (Varian Inc., Lake Forest, CA) and eluted in 5 µL of elution buffer lin e .o rg B (65% acetonitrile, 0.1% formic acid). Buffer A (80 μL of 0.1% formic acid) was added to sample by/ g u e s tubes and transferred to a 96-well microplate (Axygen, Union City, CA). Using a 96-well microplate t o n A p autosampler, 40 μL of each sample was loaded onto a 3 cm C18 trap column (inner diameter 150 μm; ril 6 , 2 0 1 9 New Objective, Woburn, MA) that was packed in-house with 5 μm Pursuit C18 (Varian Inc.). An increasing concentration of Buffer B (0.1 % formic acid in acetonitrile) was used to elute the peptides from the trap column onto a resolving analytical 5-cm PicoTip Emitter Column (inner diameter 75 μm, 8 μm tip; New Objective). This column was packed in-house using 3 μm Pursuit C18 (Varian). The EASY-nLC system (Proxeon Biosystems, Odense, Denmark) was coupled online to an LTQ-Orbitrap XL hybrid mass spectrometer (Thermo Fisher Scientific, San Jose, CA) and a nanoelectrospray ionization source (Proxeon) was used with a spray voltage of 2 kV and temperature of 160 °C. A data- 9 dependent mode was utilized to analyze samples and a full MS1 scan was acquired from 450-1450 m/z in the mass analyzer (resolution of 60, 000). This was followed by MS2 scan acquisition of the top six parent ions in the LTQ mass analyzer. The subsequent parameters were enabled: dynamic exclusion, charge state screening and monoisotopic precursor selection. Ions with charge states of +1, ≥ +4 and unassigned charge states did not undergo MS2 fragmentation. For protein identification and data analysis, XCalibur software (v. 2.0.5; Thermo Fisher) was used to generate RAW files of each MS run. RAW files were subsequently used to generate Mascot Generic Files (MGF) on Mascot Daemon (version 2.2.2). Once generated, MGFs were searched with D o w Mascot (Matrix Science, London, UK; version 2.2). Protein searches were performed against the non- n lo a d e d redundant human UniProtKB/Swiss-Prot database (version 10, October 2013) using the following fro m h parameters: fully tryptic cleavages, 7 ppm precursor ion mass tolerance, 0.4 Da fragment ion mass ttp ://w w w tolerance, allowance of one missed cleavage and fixed modifications of carbamidomethylation of .m c p o n cysteines. Variable modifications included oxidation of methionine, pyro-Glu from glutamine of the N- lin e .o rg terminus-carbamoylmethylcystein cyclization at N terminus, deamidation of glutamine, oxidation of by/ g u e s tryptophan, and acetylation of the N-terminus. t o n A p ril 6 , 2 0 1 9 Assessment of TEX101 glycosylation The TEX101 protein glycosylation was assessed by treatment of purified recombinant TEX101 protein with the deglycosylation enzyme PNGase F (Roche, Mannheim, Germany). The mixture was incubated at 37oC for 3 hours. PNGase F treated and non-treated TEX101 were subjected to SDS-PAGE stained with Coomassie Blue. 10