Zootaxa 4434 (1): 029–048 ISSN 1175-5326 (print edition) Article ZOOTAXA http://www.mapress.com/j/zt/ Copyright © 2018 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4434.1.2 http://zoobank.org/urn:lsid:zoobank.org:pub:BBD0A5B9-B363-4802-8F2B-78C0209C08D5 Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) from the Tambopata river, Madre de Dios, Peru JUAN GRADOS Departamento de Entomología, Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Apartado 14-0434, Lima 14, PERÚ. E-mail: [email protected] Abstract Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) are described. Aphyle niedmandi sp. nov., Evius ocassus sp. nov., Paranerita maculata sandeepani ssp. nov., Paranerita kotolnuki sp. nov. and Baritius flexuosus sp. nov. were collected in the Tambopata River region, Madre de Dios (Peru), as part of a Citizen Science Project, in mu- tual collaboration between the Natural History Museum (Lima–Peru) and Rainforest Expeditions. External morphological descriptions, morphology of male genitalia, and geographic distributions in Peru are given for all taxa as well as their barcoding. Key words: citizen science, Neotropical, Phaegopterina, taxonomy Introduction Advances in the last decades in the knowledge of Neotropical Arctiinae are based on phylogeny studies (Jacobson & Weller 2002; Zaspel et al. 2014; Zenker et al. 2017), revisions of some genera (Dietz & Duckworth 1976; Dietz 1994; Simmons & Weller 2006; Pinheiro & Duarte 2010; Pinheiro & Mey 2015), morphological studies (Weller et al. 2000), faunistic studies (e.g., Grados 1999, 2001; Piñas et al. 2000; Piñas & Manzano 2003; Teston & Corseuil 2004; Cerda 2008; Teston & Ferro 2016), new species descriptions (e.g., Grados 2004, 2015; Vincent 2011, Vincent et al. 2014; Coenen & Gibeaux 2014; Pinheiro 2016) and the publication of some synonyms (e.g., Grados 2002; Pinheiro & Duarte 2013; Beccacece & Zapata 2017). Systematists have always faced a great problem to correctly identify species. In the case of Arctiinae, these are partly related to the lack of sufficient material to study and to analyze in depth the traits that delimit species. It is possible to mention that at present, after 250 years of the initiation of systematists work at the world level (Linnaeus 1758; ICNZ 1999), in many species only the type specimen or the type series specimens are known. This lack of material has become more critical in the last decades, due to the innumerable demands and documents that the different governments request to make collections of biological specimens for scientific research purposes, including the loan of material among institutions dedicated to research, without getting into details on the total restrictions that some countries have. Estimates on the number of species that inhabit the planet vary depending on the authors and what groups they work on. The more conservative estimates indicate that there would be more than 5 million species (Wilson 1988; Stork 1993). With the current rate of new species descriptions, the estimate of having more than 1,500 systematic specialists worldwide and the need to have 25,000 full–time professionals to fully know the diversity of the planet, considering also that actually there is a global level reduction of resources in the formation of taxonomists, which requires years of preparation and specialization, entering the whirlpool without exit of the need, yet in turn, no investment, getting to extents such as that in many museums of the world, curators, are barely supplied for their basic tasks, the taxonomy crisis is evident, some having called this the "taxonomic impediment" to get to know the true biodiversity of the planet (Wilson 1988, Mallet & Willmott 2003, Wheeler et al. 2004, Agnarsson & Kuntner 2007). Against this background, the use of the sequencing a small 600–base pair fragment of a gene, the Accepted by L. Pinheiro: 4 May 2018; published: 14 Jun. 2018 29 Licensed under a Creative Commons Attribution License http://creativecommons.org/licenses/by/3.0 Cytochrome Oxidase subunit 1 (COI) known as "barcoding", has been proposed as a molecular universal alternative for solving the taxonomic identification problem for the rapidity, low cost and reliability, and that in the future it could replace the experience and knowledge of the traditional systematic (Hebert et al. 2003). However, some critiques have been swift to show up (Mallet & Willmott 2003), due to the limitations it presents in view of the results obtained (Rubinoff et al. 2006; Meier et al. 2006; Johnsen et al. 2010). We can mention one of the emblematic cases in Lepidoptera. The species Astraptes fulgerator has been considered as a single one, variable and with broad geographic distribution: from the southern United States to northern Argentina. By means of barcoding studies it has been proposed that it would actually be a set of 10 cryptic species (Hebert et al. 2004). However in the same study, the authors point out that with the information they have about host plants, larval coloring pattern and adult phenotype, Astraptes fulgerator would actually be composed of a complex of six or seven species. Just a controversial position is provided by Brower (2006), in relation to the molecular approach of Hebert et al. (2004). By reanalyzing the data obtained and proposing that it would be seven species instead of ten. In another study of the Ithomiinae (Nymphalidae) butterfly community of the tropical forest in Ecuador (Elias et al. 2007) it has been shown that barcoding success in species identification barely reached 77%. More and more work mentions that reliability in species identification through barcoding has serious limitations. This implies that DNA barcoding only cannot support the diagnosis of valid species, being essential to find other characters, either morphological at different stages in insects (Yassin et al. 2010), ecological, ethological or biogeographic (Dayrat 2005; Rubinoffet al. 2006; Burn et al. 2008; Yassin et al. 2010; Whinnett et al. 2005). For these reasons, I have used barcoding as one in set tools for diagnosing new species (Mallet & Willmot 2003) and not as a unique and irreplaceable tool. On the other hand, it is necessary to point out the existence of complexes of species, which have a very similar external morphology and, after doing taxonomic revisions, with studies of genitalia, have revealed the existence of complexes with greater number of species than what was known. In fact, in several of these groups, where reviews have not been carried out, mainly due to the lack of specialists, is where barcoding analysis has led to the revision and confirmation of a greater number of species. This implies that barcoding can become an alert tool for taxonomic revisions in species complexes and, in cases of twin species, to find the characters that differentiate species (De Salle 2006; Burns et al. 2008; Beccacece & Vincent 2014). It has been 14 years since Hebert et al. (2003) proposed that the COI database could be developed for the 5–10 million species of animals. For now, the information gaps are huge. The identification of species based on barcoding is limited, in addition to the factors pointed out by Rubinoff et al. (2006) and several others, by the existence of the sequencing in the database. If the sequencing does not exist, identification is not feasible and much less it is adventuring to claim that it would be an unknown species. Another important factor is who identifies the species, since the database is the starting point for other users to take this as a reference. Just as in the morphological systematics, it is essential and necessary in order to have objectivity, to review the primary sources, that is, to analyze the types. In the same way the barcode would need to be nourished from the same sources. The usefulness of the databases will increase to the extent that they are more complete for the respective groups to be analyzed. In this work, for each species is provided a diagnosis, external morphological descriptions, internal anatomy characters of males genitalia, geographic distributions and the sequencing of the mitochondrial gene, Cytochrome C Oxidase subunit 1 (COI). Materials and methods The descriptions of the four new species and one new subspecies are the result of daily collections at Refugio Amazonas Lodge (ARA), located at the right bank of the Tambopata River (Madre de Dios, Peru), as part of a Citizen Science program, whom direct participants were guests of the Lodge, with the mutual collaboration between the Natural History Museum (MUSM) and the company Rainforest Expeditions. A light trap with a mixed light bulb of 250 V was used to capture the specimens. The samples were sacrificed using a butyl acetate lethal jar, and were processed at the Museo de Historia Natural, Universidad Nacional Mayor de San Marcos. The sequencing of the mitochondrial gene, Cytochrome C Oxidase subunit 1 (COI), was carried out in the Biodiversity Institute of Ontario, University of Guelph, according to the protocol described in Vaglia et al. (2008). All samples (tissue from right hind legs) submitted for sequencing were from Tambopata River (Madre de Dios, Peru). The 30 · Zootaxa 4434 (1) © 2018 Magnolia Press GRADOS distance was calculated using MEGA7 (Kumar et al. 2015), using Kimura 2-parameter model. The abdomens and genitalia of the male specimens were dissected and prepared using hot KOH solution (10%). Photographs of adults were taken with a Nikon D80 and the photographs of the genitalia with a Canon EOS Rebel T6. The entomological collections revised for the elaboration of this work were: (MUSM) Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; (NHMUK) Natural History Museum, London, United Kingdom; (USNM) United States National Museum, Smithsonian Institution, USA. All specimens have been deposited in the Museo de Historia Natural, Universidad Nacional Mayor de San Marcos (MUSM). Wing venation terminology follows Comstock & Needham (1898, 1899), Miller (1970) & Common (1990). Genitalia terminology follows Sibatani et al. (1954), Kuznetsov (1967) and Klots (1970). The species sequencing are available on GenBank; the accession numbers are provided in the treatment of each species below. Results Aphyle niedmandi sp. nov. (Figs. 1–8, 12, 14, 16) Holotype male (Figs. 1–2): PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 17.vii.2016 (D. Couceiro). 20 paratypes (15 males and 5 females): PERU, Loreto, 1 male, Campamento Paiche (Río Curaray), 01°29'25''S, 75°23'53''W, 200m, 02.iii.2008 (W. Yawuarcani); 1 male, Campamento Dorado (Quebrada Rumiyacu), 01°48'09''S, 75°29'14''W, 230m, 23.ii.2008 (W. Yawuarcani). Ucayali, 1 male, Quebrada Shaguauya, 08°39'12''S, 73°21'25''W, 275m, 04.xi.2008 (S. Carbonel). Junin, 1 male, Río Venado, 1050m, 01.i.2009 (V. Izerskyy). CUSCO, 1 male, 1 female, Cashiriari, 11°52'S, 72°39'W, 690m, 02.xii.1997 (J. Grados); 1 male, C.C. Kitaparay, 12°12'47.73''S, 72°49'11.42''W, 474m, 13.xi.2009 (C. Espinoza & E. Rázuri); 1 male, C.C. Timpia, 12°06'52.69''S, 72°49'48.64''W, 486m, 21.x.2009 (M. Alvarado & E. Rázuri); 1 female, 12 km O de Sonampiato, 12°39'52.07''S,73°14'35.01''W, 887m, 30.v.2011 (C. Espinoza); 1 female, Campamento Comerciato, 12°47'S, 73°22'W, 1360m, 18.xi.2002 (J. Grados). Madre de Dios, 1 male, CICRA (Río Los Amigos), 12°33'36.3''S, 70°06'17.3''W, 280m, 10.xii.2005 (J. Grados); 1 female, idem except, 06.xii.2005; 1 male, idem except, 01.v.2006 (A. Asenjo); 1 male, idem except, 29.x.2006 (A. Asenjo); 1 male, idem except, 17.xi.2006 (A. Asenjo); 1 male, idem except, 23.viii–15.ix.2008 (A. Asenjo); 1 female, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 07.iv.2016 (Harald Niedman, Karen Niedman, Emily Niedman, Dominic Niedman & D. Couceiro); 1 male, idem except, 10.viii.2016 (D. Couceiro); 1 male, idem except, 02.x.2016 (D. Couceiro); 1 male, idem except, 07.x.2016 (D. Couceiro). Diagnosis (male and female): Head creamy, frontoclypeous light brown, with a black spot between antennae. Thorax creamy white, patagia black with blue iridescence. Two black dots on medial part of mesoscutum, and another two on central part of mesoscutellum. Forewing creamy brown, with two small black spots on its base. A continuous series of five black spots close to wing base, from costal margin until below vein 1A+2A, arranged , crosswise. Black dots close to apex and tornus. Hindwing diaphanous creamy white, with creamy hairs on inner margin. Abdomen creamy yellow dorsally, whitish ventrally. Description male (Figs. 1–2) and female (Figs.3–4). Forewing span: 9–12 mm in males (n=16), 20–21 mm in females (n=5). Head: Frontoclypeous light brown. Between the scapes, a black line. Posterior margin of vertex with light brown scales. Palpi black with blue iridescence, except for the frontal surface of first palpomere, and proximal frontal surfaces of second and third palpomeres, creamy white. Occiput whitish laterally. Antennae creamy, slightly bipectinated with very small rami. Thorax: Creamy white. Patagia black with blue iridescence, and a white line on anterior surface, plus a creamy transversal line before posterior margin. Tegulae creamy with a black line across situated before the beginning of the first pair of wings and a black spot towards tegulae posterior. Two black dots on medial surface of mesoscutum, and two other on the medial part of the mesoscutellum. Creamy hair-like scales laterally between metascutum and metascutellum. Prothoracic legs creamy white. Prothoracic femora with a black spot on inner surface, about three quarters from distal end of the segment. Another black spot on inner distal surface of tibia. Proximal surface of the last four tarsal segments brown scaled. Mesothoracic legs creamy with two brown spots, on distal end of femora and on proximal end of tibiae. Metathoracic legs entirely creamy. FOUR NEW SPECIES AND ONE NEW SUBSPECIES FROM PERU. Zootaxa 4434 (1) © 2018 Magnolia Press · 31 FIGURES 1–4. Aphyle niedmandi Grados new species. 1. Holotype male, dorsal. 2. Holotype male, ventral. 3. Paratype female, dorsal (CICRA, Río Los Amigos). 4. Paratype female, ventral. Scales=10 mm. FIGURES 5–8. Genitalia of Aphyle niedmandi Grados, new species. (Genitalia # JGA–729). 5. Dorsal view. 6. Ventral view. 7. Lateral view. 8. Aedeagus. Scales= 1 mm. Forewing: Dorsal surface with costal margin sandy brown. Two small black spots on the wing base. A continuous series of five black spots close to the wing base, going from costal margin until below vein 1A+2A, arranged crosswise. Very close to these, a brown spot from C to the 2A. Also very close to these and towards the distal surface, a black spot between C and 2A. Two black spots inside discal cell, the larger one close to the wing base. On proximal surface of cell C-C , a black elongated spot. Below the beginning of Cu-1A, another black 1 2 2 elongated spot. A large, elongated spot on anal cell, comprising the vein 2A and reaching posterior margin. Veins M, M and M brown. This color not reaching the termen. Three black points near apex: between veins R and R, 1 2 3 3 4 R and R, and R and M. Three black spots reaching termen, wider towards mesal area; between M-M , M-M 4 5 5 1 1 2 2 3 and M-CU. A sandy brown spot towards the proximal region. A series of black dots located between M and 3 1 3 tornus: an elongated dot obliquely arranged on subdistal part of M-Cu; a dot subdistal on Cu-Cu; a black spot on 3 1 1 2 Cu-1A; a subdistal black dot on 1A-2A; finally, a dot on tornus. Tornus with a sandy brown spot. Ventral surface 2 creamy whitish and hyaline. A series of black dots present near apex, similar to those on dorsal side, but smaller: between veins R and R, R and R, and R and M. Three black spots reaching termen and wider towards mesal 3 4 4 5 5 1 32 · Zootaxa 4434 (1) © 2018 Magnolia Press GRADOS area, but nos as dark as the dorsal side: between M-M , M-M and M-CU. Hindwing: Both dorsal and ventral 1 2 2 3 3 1 surfaces identical. Creamy witish and hyaline, with creamy hairs on inner margin. Abdomen: Creamy yellowish dorsally, slightly hairy on first three terga, with creamy and white hairs on remaining terga. White ventrally. Male genitalia (Figs. 5–8) (Genitalia # JGA 729): Tegumen short. Uncus wide at base; in dorsal view thinning towards distal end, and more sclerotized towards the tip; in lateral view, wider medially. Sacculus elongated and ventral process of valvae short and rounded. Dorsal process of valvae elongated and curved, twice the length of ventral process. Aedeagus with small caecum penis. Vesica with a membranous process towards the ventral side and elongated dorsal process. Numerous cornuti on a well delimited on distal process. FIGURES 9–10. Holotype of Aphyle cuneata Hampson. 9. Dorsal view. 10. Ventral view. Etymology: niedmandi is a singular genitive noun, dedicated to the Niedmand family for being the first ones to collect specimens of the new species at the Refugio Amazonas Lodge. Distribution: Known from the departments of Loreto, Ucayali, Junin and Madre de Dios (Peruvian Amazon). Barcoding: The access number to Genbank is MG837873. The mitochondrial DNA sequence (COI) of one of the paratypes is as follows (Voucher MUSM–Arctiinae VB # 33): AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTTTATTAATCCGAGCTG AATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACTGCTCATGCTTTT ATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTA GGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCATCTTTAACTT TATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCA TCAAATATCGCCCATGGAGGAAGATCTGTAGATCTAGCTATTTTCTCCCTACATTTAGCAGGTATCTCAT CAATTTTAGGTGCAATTAATTTTATTACCACAATCATTAATATACGATTAAATAATTTATCATTTGATCAA ATACCATTATTTGTTTGAGCAGTAGGTATTACAGCATTTTTATTACTATTATCTCTCCCAGTTTTAGCTGG AGCTATTACAATATTATTAACTGATCGAAATTTAAACACATCTTTTTTTGACCCTGCTGGAGGGGGGGA TCCCATCCTCTATCAACATTTATTT Remarks: Aphyle cuneata Hampson, 1905 was described from a male specimen of the Potaro River (Guyana), type deposited at the NHMUK (Figs. 9–10). The new species has a color pattern and external morphology similar to A. cuneata, differing from it in the black spots on the wing base: The spot at very base of the wing and the largest proximal patch are continuos in A. cuneate, while in A. niedmandi are discontinuous, with tiny spots. The genitalia morphology is very similar in both species; the most notorious differences are in the antennae and eighth tergite and sternite. Antennae are bipectinated in both taxa, but the rami have almost the same length of the shaft in A. cuneata, giving it a pentagonal shape (Fig. 15), while in A. niedmandi they are shorter, so the flagellomeres are rectangular shaped (Fig. 16). The eighth tergite of A. cuneata has large lateral apodemes, one quarter the length of the entire tergite (Fig. 11). FOUR NEW SPECIES AND ONE NEW SUBSPECIES FROM PERU. Zootaxa 4434 (1) © 2018 Magnolia Press · 33 In A. niedmandi the tergite is wider, and the apodemes are small (Fig. 12). In the eighth sternite, the apodeme of A. cuneata is broad and has lateral extensions (Fig. 13), whereas in A. niedmandi the apodeme is narrow and continuous along the anterior border (Fig. 14). Aphyle cuneata occurs in Guyana, French Guiana (MHNP), Ecuador (Piñas et al. 2000), and Peru. For the latter country, there are records from the departments of Loreto, Cusco and Madre de Dios. Aphyle niedmandi, on its turn, has been recorded from Loreto, Ucayali, Junín, Cusco and Madre de Dios. The genetic distance between both species is 5.52%. FIGURES 11–16. Tergites y sternites of A. niedmandi Grados and A. cuneata Hampson. 11. Tergite VIII of A. cuneata. 12. Tergite VIII of A. niedmandi. 13. Sternite VIII of A. cuneata. 14. Sternite VIII of A. niedmandi. (Scales=1 mm). 15. Middle antennal segments of A. cuneata. 16. Middle antennal segments of A. niedmandi. (Scales=0.5 mm). 34 · Zootaxa 4434 (1) © 2018 Magnolia Press GRADOS Evius ocassus sp. nov. (Figs. 17–24) Holotype male (Figs. 17–18): PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 21.iv.2016 (D. Couceiro). 73 Paratypes (42 males and 31 females): PERU, Madre de Dios, 1 male, CICRA, Río Los Amigos, 12°34'07.35''S, 70°05'56.8''W, 380m, 08.xii.2005 (J. Grados); 2 males, Madre de Dios, CICRA, Río Los Amigos, 12°33'36.3''S, 70°06'17.3''W, 380m, 09.xii.2005 (J. Grados); 7 males, idem except, 10.xii.2005; 1 female, idem except, 23.vii.2006 (A. Asenjo); 1 male, idem except, 26.vii.2006; 1 female, idem except, 28.vii.2006; 1 male, idem except, 02.viii.2006; 1 male, idem except 15.ix.2006; 1 male, idem except, 13.i.2007; 2 males, idem, except, 19.i.2007; 2 males, idem except, 21.i.2007; 1 male, 1 female, Alto Madre de Dios, Albergue Pantiacolla, nr. 12°47'S, 71°13'W, 450m, 30.ix–03.x.1998 (J. Grados); 1 male, Río Alto Madre de Dios, nr. Atalaya, 12°53'S, 71°22'W, 587m, 01.v.2006 (P. Centeno); 1 female, idem except, 16.ii.2007; 1 male, 1 female, idem except, 17.ii.2007; 1 male, idem except, 18.ii.2007; 2 males, idem except, 20.ii.2007; 2 males, 1 female, idem except, 21.ii.2007; 2 males, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 23.ii.2016 (J. Grados); 1 female, idem except, 25.ii.2016; 1 female, idem except, 27.ii.2016; 1 female, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 06.iv.2016 (D. Couceiro); 1 male, idem except, 12.iv.2016 (Michael Loia, Gina Loia, Giovana Loia & D. Couceiro); 2 females, idem except, 13.iv.2016; 1 female, idem except, 14.iv.2016; 1 male, 1 female, idem except, 15.iv.2016; 3 females, idem except, 16.iv.2016; 1 female, idem except, 17.iv.2016; 1 female, idem except, 18.iv.2016; 1 female, idem except, 19.iv.2016; 3 females, idem except, 20.iv.2016; 2 males, 5 females, idem except, 21.iv.2016; 2 males, idem except, 27.iv.2016; 1 female, idem except, 30.iv.2016; 1 male, idem except, 03.v.2016; 1 female, idem except, 07.v.2016; 1 female, idem except, 20.v.2016; 1 female, idem except, 27.v.2016; 1 female, idem except, 19.viii.2016; 1 female, idem except, 02.x.2016; 1 male, idem except, 08.x.2016; 1 male, idem except, 20.x.2016; 2 males, idem except, 21.x.2016; 1male, idem except, 22.x.2016. FIGURES 17–20. Evius ocassus Grados new species. 17. Holotype male, dorsal. 18. Holotype male, ventral. 19. Paratype female, dorsal (Albergue Refugio Amazonas). 20. Paratype female, ventral. Scales=10 mm. Diagnosis (male and female): Head and patagia reddish yellow. Tegulae and thorax brown with yellow areas and red scales. Forewing with large reddish brown area of bluish hue at the two proximal thirds: rising from the tornus up to Cu where it projects towards the mesal margin reaching M and then towards the ectal margin 1, 3 , reaching the intersection of M and R+R It projects towards cell R comprising the proximal half, and this part 1 4 5. 5, being red with brown scales. White costal margin, from the base up to the level of R+R and M Creamy 4 5 1. translucent hind wings from the middle to the costal margin. The other half is yellow with a soft reddish hue. The new species is recognizable for bearing a reddish brown spot from the joining of R y R, up to the middle area of 4 5 the R cell. 5 FOUR NEW SPECIES AND ONE NEW SUBSPECIES FROM PERU. Zootaxa 4434 (1) © 2018 Magnolia Press · 35 Descrition male (Figs. 17–18) and female (Figs. 19–20). Forewing span: 14–16 mm in males (n=42), 16–17 mm in females) (n=31). Head: Bottom half of the frons brown. Transverse red line rises by its sides up to the base of the antennae. Vertex and upper half of the frons yellow. Occiput with a line of red scales. Proboscis brown. First palpi segment red to the sides and white on the front. Second segment brown on the front and the inner sides and red on the outer sides. Third segment minute, reddish with brown front and inner sides. Antennae brown, except for the scape and pedicel, with red scales at the base of the flagellum and white ones at the distal forth part. The rami are minute. In female, the antennae are thinner. Thorax: Patagia reddish yellow, due to disperse presence of scales of both colors. A marked red spot at the antero–lateral area. Tegula brown with red scales at the postero–lateral part. Yellow spot at the mesal margin of the anterior part, limited by a red edge. Brown mesoscutum, with the anterior part yellow, speckled which presents red scales. A longitudinal line of red scales at the central part. Posterolateral part with white and red scales. Brown mesoscutellum. Metascutum covered with reddish hair and metascutellum red. First pair of legs white, with the front part of the coxa, the mesal area of the femur and tibia, red. Ectal area of the three first tarsal segments red. The last two red. Second and third pair of legs white. Forewing; Dorsal surface with a large reddish brown area with a soft purple reflection, that covers two thirds of the wings, from the base to the external margin. The edge of the spot, towards the external margin delimited with red scales. The limit of the area reaches the tornus, rising up to Cu from where it projects towards the mesal 1, margin reaching M to go to the ectal margin, reaching the intersection of M and R+R It projects to R-M , 3, 1 4 5. 5 1 covering the proximal half, this part being red with brown scales. Costal margin white, from the base up to the level of R+R . From this point, up to the apex, brown. Under the costal margin, from the middle up to the external 4 5 margin, very close to the apex, presence of a thin red line. Another red thin line over R. Third external part of the wing, towards the margin, yellow with three brown dots. Each one in the respective cell R-M ,M-M -M. Disperse 5 1 1 2 reddish scales at the base of the wing and a red spot at the base of the anal cell Ventral surface with costal margin . white, from the base of the wing up to the beginning of the M and from there up to the apex, turning broader and 1, brown. A large red spot comprising the anterior part of the discal cell and the proximal areas of cells M-M and M- 2 3 3 Cu projects towards the posterior part, covering like a thin line the middle part of Cu-Cu, the distal part of Cu-1A 1, 1 2 and the distal part of 1A-2A, reaching the tornus. Tornus with yellow scales. A brown spot in the proximal part of the M-M . An area with whitish scales comprises the posterior part of the discal cell, the posterior and proximal 1 2 half of Cu Cu, almost all Cu-1A, 2A-1A and the analcell. Three small brown spots located on each of cells R-M 1- 2 2 5 1, M-M and M-M . Hindwing: Rounded. Dorsal surface with the area from the costal margin, the discal cell to M- 1 2 2 3 3 C, with creamy scales; an elongated area in the proximal half of Cu-Cu and the proximal area of M-Cu, 1 1 2 3 1 semihyaline; the rest of the wing, with cream and red scales. In females, the hindwings oblong and the dorsal surface reddish. Ventral surface yellow, semihyaline in the proximal half of Cu-Cu and the proximal area of M- 1 2 3 Cu. Abdomen: Red with a white point at the anterior central part of the first tergite. White scales present on the 1 posterolateral parts from the fourth to seventh tergite. White scales at the posterior part of the last tergite. White ventrally. Male genitalia (Figs. 21–24) (Genitalia # JGA 767): Uncus elongated, setose and lightly curved downward ventrally at the tip. Sacculus elongated, with setae along its margin, being more abundant towards the distal extreme. Ventral process small, oval and membranous. Dorsal process elongated, curved and thin, being three times larger than the ventral process. It bears setae on its distal extreme. Juxta elongated. Transtilla broad, reaching half of the width of each sacculus. Caecum penis short. Vesica short, expanding towards the ventral part; and with a short and thin extension towards the dorsal part. Etymology: ocassus is an adjective in singular nominative which means sunset. It is an allusion to the wing color. Distribution: Known only from the department of Madre de Dios, southeast of the Peruvian Amazon. At the moment, its area of distribution includes the Tambopata River and the Madre de Dios River. Evius ocassus is common in its type locality. Barcoding: The access number to Genbank is MG837874. The mitochondrial DNA sequence (COI) of one of the paratypes is as follows (Voucher MUSM–Arctiinae VB # 86): AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGACTATTAATTCGTGCA GAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACTGCCCATGCTT TTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATT 36 · Zootaxa 4434 (1) © 2018 Magnolia Press GRADOS AGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTGCCCCCTTCTTTAACA TTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTC TTCCAATATTGCTCACGGAGGAAGATCTGTAGACCTAGCTATTTTTTCTCTTCATTTAGCTGGAATCTCA TCAATTTTAGGGGCAATTAATTTTATCACTACAATTATCAATATACGACTAAATAATTTATCATTTGACCA AATACCACTATTTGTGTGAGCCGTCGGAATTACTGCATTTTTATTATTATTATCTTTACCTGTATTAGCAG GAGCTATTACTATATTATTAACTGACCGAAATCTAAATACATCTTTTTTCGACCCAGCAGGTGGGGGTG ATCCTATTCTTTATCAGCATTTATTT Remarks: Evius ocassus is very similar to E. roseosimulans Coenen & Gibeaux, 2013 which has recently been described from from French Guiana. The new species differs from it in the reddish brown spot on the junction of R 4 and R, going up to the middle area of cell R-M , which is not observed in E. roseosimulans. Both species also 5 5 1 differ in the genitalia, where the proportion of the sizes of ventral and dorsal processes of the valvae. While in E. roseosimulans the dorsal process is less than double the size of the ventral one, in Evius ocassus n. sp. the dorsal process is three times that of the ventral. Another species resembling E. ocassus is E. cochenouri Schaus, 1910, described from Juan Viñas, El Sitio (Costa Rica). This species is easy to tell apart from E. ocassus because E. cochenouri has yellow patagia, while they are reddish yellow; in E. cochenouri has a reddish brown area not reaching tornus of forewings, whereas in E. ocassus it does. FIGURES 21–24. Genitalia of Evius ocassus Grados, new species. (Genitalia # JGA–767). 21. Dorsal view. 22. Ventral view. 23. Lateral view. 24. Aedeagus. Scales= 1 mm. Paranerita kotolnuki sp. nov. (Figs. 25–30) Holotype male (Figs. 25–26): PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 18.iv.2016 (Michael Galizio & D. Couceiro). 11 paratypes (11 males): PERU, Madre de Dios, 2 males, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 19.iv.2016 (D. Couceiro); 1 male, idem except, 21.iv.2016; 1 male, idem except, 30.iv.2016 (Marci Kotolnuk); 1 male, idem except, 02.v.2016; 2 males, idem except, 21.v.2016; 1 male, idem except, 09.x.2016; 1 male, idem except, 10.x.2016; 1 male, idem except, 13.x.2016; 1 male, idem except, 24.x.2016 (J. Grados & D. Couceiro). Diagnosis (male): Small species (11–12mm) with yellow head and yellow patagia, the latter with red spots. Brown tegulae with reddish spots. First pair of wings brown with iridescent purple scales, and with several yellow spots of reddish edges. Second pair of wings with a soft reddish hue and part of the edge of the termen brown. Abdomen red dorsally and white ventrally. FOUR NEW SPECIES AND ONE NEW SUBSPECIES FROM PERU. Zootaxa 4434 (1) © 2018 Magnolia Press · 37 FIGURES 25–26. Paranerita kotolnuki Grados, new especies. 25. Holotype male, dorsal. 26. Holotype male, ventral. Scales=5 mm. Description male (Figs. 25–26) and females. Forewing span; 11–12 mm (n=12). Head: Frontoclypeus yellow, the upper part with brown scales on the sides, underneath the antennae. Vertex yellow, with groups of red scales at the base of the antennae, in the anterior part, above the brown scales. Red scales on the lateral parts of the vertex and occiput. Palpi with the first segment yellow and red scales on the external lateral side. Second and third segments red, with the front brown and the inner part yellow. Antennae bipectinate, with scape and pedicel presenting yellow and red scales. Flagellum brown with of red scales present towards the base and white scales in the distal quarter. Thorax: Patagia yellow, bearing a brown spot in the anterior part of the ectal margin. Adjacent to this, a red submarginal band runs from the anterior to the posterior side and then all along the edge back to anterior side. Tegula brown in the anterior part; the posterior side and mesal margin, red; the posterior part and ectal margin, yellow. Mesoscutum brown, with presence of a small triangular red spot in the central anterior part; red spots on the central and lateral parts of the ectal margin. Metascutellum brown. First pair of legs yellow, with the front of the coxae, the dorsal sides of the femur, tibia and tarsi, reddish. Second and third pair of legs yellow. Forewing: Dorsal surface brown with an iridescent bluish reflection. It bears yellow and red spots. A yellow spot near the base of the wing, surrounded by an irregular red band. The contour comprises near the base of the wing and below the costal margin, reaches the inner part of the base of the discal cell, crosses the Cu, projects up to below the 1A and 2A, extending towards the base of the wing. Red at the base of the R and the 1A + 2A. A bulging area at the base of the wing: below the Cu, the first quarter of the Cu2-1A. Two spots of red contours and inner part yellow: one in the central part of anal cell reaching the posterior margin; the other in the posterodistal part of the bulging area, on Cu- 2 1A. A large spot, of red contour and yellow inner part, located in the anterior and central part of the wing: originates from the proximal third of the wing, in the costal margin, extends obliquely towards the external margin, reaching the posterior angle of the discal cell, where M and M arise, crosses the middle part of the Cu-Cu, then 2 3 1 2 ascending, across the Cu, M and M up to the sixth part of the M, from where it projects up to the apex. Termen 1 3 2 1 yellow. An irregular patch alongside the termen, with the inner edge red and inner part yellow: arises near the tornus, rising sinusoidally to become wider in M-M , where it also closes until it reaches the termen, spot rises 2 3 again obliquely towards the inside of the wing, crossing M, to become wider in R-M , Describing a last curve this 1 5 1 crosses above, heading towards the termen but not reaching it, from where it rises obliquely reaching the middle part of R-R. A red spot, near the tornus, another near the base of the R-R and another one in R-M. Retinaculum 4 5 5 4 5 1 reddish yellow. Ventral surface yellow, with the spot located on the termen with the same characteristics as the dorsal side, except for the colors that are not intense. A central brown spot, running from the costal margin down to the tornus with red edges on each side: the first one with the red edge projecting towards the tornus and the second one comprises part of the discal cell, reaching up to the costal margin and running down to the base of the wing. The proximal half of the wing, yellow, with the presence of a cleft corresponding to the described area of the bulging area on the dorsal side. This cleft shows tufts of yellow androconial hairs. Retinaculum yellow with brown scales. Hindwing: Dorsal surface yellow, from the costal margin, which is lobulated, to the Cu, reaching the M. A 3 brown edge from the M, becoming thinner and reaching 2A. The rest of the wing with a soft reddish hue. Ventral 3 surface yellow with the same characteristics regarding the brown spot on the dorsal side. Abdomen: Dorsal side red, with yellow scales in the posterior and central part of the first sternite. The other sternites have yellow scales on the posterior edges. Yellowish white ventral side. Male genitalia (Figs. 27–30) (Genitalia # JGA 560, 750, 761): Saccus thick, curved and oblique pointing to the left side. Tegumen with elongated sides, sharpened towards 38 · Zootaxa 4434 (1) © 2018 Magnolia Press GRADOS