Iranian J Parasitol: Vol. 8, No.1, Jan-Mar 2013, pp. 33-39 Iranian J Parasitol Te hran University of Medical Open access Journal at Sciences Publication http:// ijpa.tums.ac.ir Iranian Society of Parasitology http:// tums.ac.ir http:// isp.tums.ac.ir Original Article Ficolin-A Enhances Inhibition of the C-Terminal 19 kDa Region of Merozoite Surface Protein-1 of Plasmodium berghei Using Test In Vivo †F Chen 1, †Q Liu 2, Y Xue 3, YH Huang 2, FY Huang 2, Y Lin 2, GH Tan 2, *J Zhou 4 1. The Faculty of Life Sciences, Hubei University, 368 Youyi Road, Wuchang, Wuhan 430062, China 2. Hainan Provincial Key Laboratory of Tropical Medicine, Pharmacy School, Hainan Medical College, Haikou 571199, China 3. Lab of Medical Engineering, College of Medical Technology and Engineering, Henan University of Science and Techology, Luoyang 471003, China 4. Wuhan Tuberculosis Dispensary, 28 Baofeng Road, Qiaokou, Wuhan, 430030, China † Fan Chen and Qiang Liu are co-primary authors *Corresponding author: Tel.: 86-898-83602375, Email: [email protected] (Received 15 Oct 2012; accepted 09 Jan 2013) ABSTRACT Background: Malaria remains a serious public health problem with significant morbidity and mortal- ity. This study was conducted to identify whether ficolin-A could play an active role of against mala- ria infection. Methods: The function of ficolin-A was analyzed in mouse model. The open reading frame of fico- lin-A was cloned from the liver of new born C57BL/6 mice by RT-PCR and then inserted into the expression vector of eukaryon to construct pVAX1-ficolin-A plasmid. Meanwhile, the open reading frame of the 19-kDa fragment of merozoite surface protein-1 of Plasmodium berghei (MSP1 ) was 19 cloned and then the expression vector of eukaryon, pVAX1- MSP1 was constructed. Both recom- 19 binant vectors were used in the mouse model of infection by Plasmodium berghei. Results: pVAX1-ficolin-A alone could not significantly suppress parasite density and prolong sur- vival time of infection mice; however, when injected pVAX1-ficolin-A and pVAX1- MSP1 together, 19 the percent of invasion by Plasmodium was decreased (from 43.78% to 22.23% at 10 day after infec- tion, compared to vector ) and the survival time was prolonged significantly in the infection mouse model (P=0.01). Conclusion: Ficolin-A can enhance the immunoprotection of MSP1 , it implies ficolin-A may be 19 used as immunoenhancer in the study of vaccine defending malaria. Keywords: Ficolin-A, Plasmodium berghei, MSP1 19 33 Available at: http://ijpa.tums.ac.ir Chen, Liu et al.: Ficolin-A Enhances Inhibition of the C-Terminal 19 kDa … Introduction M alaria remains one of the world’s ma- is a leading malaria vaccine candidate antigen jor health problems, causing nearly a (14). MSP1 contains many fragments, it is pro- million deaths per year (1). Vaccina- duced during schizogony and merozoite matu- tion has been considered as an approach that ration, and only the C terminal 19-kDa frag- will complement other strategies for the pre- ment of MSP-1 (MSP1 ) remains on the 19 vention of this disease. Protection against in- merozoite surface during erythrocyte invasion fection lies on the host’s ability to identify and and therefore is an ideal target for blocking eliminate pathogens while preserving its own parasite invasion into the erythrocyte (15). integrity. To fulfill this challenge, hosts have MSP1 is highly conserved and composed of 19 evolved two complementary systems, innate two epidermal growth factor-like domains immunity and adaptive immunity. The innate which contain protective epitopes (16, 17). system not only represents the first line of de- There are considerable evidences that the fense against pathogens, but also stimulates and MSP-1 19-kDa antigen of protozoan parasites orientates the adaptive response that then pro- is the target of protective immune response. vides a delayed but memorized response to in- Immunization with recombinant MSP1 of 19 fection (2). Ficolins are a group of proteins protozoan parasites formulated with Freund’s mainly consisting of collagen-like and fibrino- adjuvant or as a GST(glutathione S-transferas) gen-like domains and thought to play a role in fusion protein produced can protect monkeys innate immunity via their carbohydrate- bind- or mice, respectively, against challenge infec- ing activities (3, 4). Three types of human tion (18, 19). However, such protection re- ficolins have been identified: L-ficolin, H- quires formulations unacceptable for human ficolin and M-ficolin, which act as opsonins use because of their high toxicity and adverse and lead to complement activation (5, 6). L- effects. Single MSP1 could not form protec- 19 ficolin has been demonstrated could inhibit tion antibody titer; the mechanism of action of influenza A virus infection both in vitro and in these antibodies is unknown. Therefore, vivo (7).Two types of ficolins have been identi- MSP1 is an ideal protein to clarity whether 19 fied in mice, ficolin A, and ficolin B (8, 9). ficonlin-A play an active role in Plasmodium Ficolin A is expressed mainly in the liver and infection model. presents in the circulation, ficolin B was mainly This study was conducted to identify whether expressed in a myeloid cell lineage in bone mar- ficolin-A could play an active role of against row but has not been isolated at the protein malaria infection. level yet (10). Ficolin-A plays a crucial role in host defense as a pathogen-associated molecu- Materials and Methods lar patterns (PAMPs) recognition molecule, which is executed through the lectin comple- Mice and parasites ment pathway. It has demonstrated significant Specific pathogen-free (SPF) newborn inhibition of Staphylococcus aureus growth in C57BL/6J mice, female BALB/c mice be- mouse model (11). However, little is known tween 5 and 6 weeks of age were purchased about the function of ficolin-A in defense Plas- from the Experimental Animal Center of Hai- modium infection. nan Province, People’s Republic of China. Many malaria vaccine candidates have been The mice were housed in macrolon cages in a developed, and some of them are being tested laminar flow cabinet and provided with oval- in ongoing clinical trials (12, 13). Among these bumin-free food and water adlibitum. Animals antigens, Merozoite surface protein 1 (MSP1) were handled and treated in accordance with Available at: http://ijpa.tums.ac.ir 34 Iranian J Parasitol: Vol. 8, No.1, Jan-Mar 2013, pp. 33-39 the guidelines of Dutch Committee on Animal 1640 (Invitrogen, Carlsbad, CA, USA) con- Experimentations. Plasmodium berghei, NK65, a taining 10% FCS, 2mM glutamine, 100 U/ml lethal murine malaria parasite, was maintained penicillin, and 100ug/ml streptomycin. COS7 in our laboratory and used for challenge infec- cells were then incubated in 5% CO2 until tion. Experiments were conducted under a 80% confluent. Plasmids expressing ficolin-A protocol approved by the Institutional Animal and MSP1 were purified using endotoxinfree 19 Care and Use Committee of Hainan Provincial DNA extraction kit (Qiagen). Four µg of Key Laboratory of Tropical Medicine. plasmid DNA was used to transfect COS7 cells respectively, using Lipofectin 2000 (Invi- Preparation of recombinant ficolin-A trogen) according to the manufacturer’s in- Total RNA was extracted from newborn structions. Media was changed 24h after trans- C57BL/6J mice liver, and reverse-transcribed fection. Cells were harvested 48h post- using Superscript III (Invitrogen, Carlsbad, transfection and suspended in PBS. The su- CA). PCR was performed using the cDNA as pernatant was then collected and subjected to template to amplify ficolin-A cDNA fragment Western blotting. covering nucleotides 91–1040 (Gene- Bank031348), by using a primer pair (5′- Western blots CGGATCCATATGCAGTGGCCTACGC- Whole cell lysates were prepared in lysis buffer 3′and5′-CGAATTCGA- (150 mM NaCl, 50 mM Tris–HCl (pH 7.4), GACTGGGGCACCTTA -3′, where the un- COS7 supernatants were fractionated by SDS- derlines denote the engineered restriction sites, PAGE on 12% (v/v) polyacrylamide gels un- BamHI and EcoRI， respectively). The result- der reducing conditions and transferred ing PCR products were cloned into pVAX1 electrophoretically to nitrocellulose mem- (Invitrogen， Carlsbad, CA) and sequenced. branes. The membranes were then blocked in 5% milk powder overnight at 4 °C. The mem- Generation recombinant MSP1 branes were probed with rabbit anti-ficolin A 19 MSP1 gene sequences were obtained by PCR or anti- Plasmodium rabbit polyclonal antibo- 19 amplification using Platinum Taq DNA poly- dies in PBS containing 0.1% Tween-20 respec- merase (TaKaRa). Template for the amplifi- tively. After washing, the filters were further cations were obtained from Plasmodium berghei incubated with horseradish peroxidase (HRP)- blood stages, the MSP1 fragment, containing conjugated anti-rabbit IgG as a second anti- 19 nucleotides 5023–5319 (GeneBank, body and blots were developed by AF187232), amplified by using a primer pair diaminobenzidine tetrahydrochloride (DAB) (CGGGATCCATGCTTAATATGGAT and detection (Pierce). CGGAATTCTTATGCATTAGGGGT), where the underlines denote the engineered Immunization protocol restriction sites, BamHI and EcoRI， respec- The plasmid (pVAX1-ficolin-A and pVAX1- MSP1 ) was propagated in Escherichia coli tively. Fragments were cloned into pVAX1 19 (DH5α). Large-scale purification of the ex- (Invitrogen) and sequenced. pression vector was conducted with Endo Free Plasmid Giga kits (Qiagen, Hilden, Ger- Mammalian cell transient transfection many) according to the manufacturer’s proto- with pVAX1-ficolin-A and pVAX1- MSP1 19 col. The plasmid DNA was stored in endo- Plasmids were tested for expression in COS7 toxin-free H O at -20°C. All mice were female cells prior to use in animals. For transient 2 BALB/c mice, and 5–6 weeks of age at the transfection experiments, freshly grown COS7 cells were seeded at 2×105 cells per 35mm tis- time of first vaccination. Five groups were set: PBS, pVAX1, pVAX1-Ficolin-A, pVAX1- sue culture dish. Cells were grown in RPMI 35 Available at: http://ijpa.tums.ac.ir Chen, Liu et al.: Ficolin-A Enhances Inhibition of the C-Terminal 19 kDa … ficolin-A and pVAX1- MSP1 pVAX1- Results 19, MSP1 each group include eight mice. Intra- 19, muscular (IM) DNA plasmids were delivered Clone and express of ficolin-A and MSP1 19 into the tibialis anterior muscle (100µg total) in The open reading frame of ficolin-A was ob- 100µl PBS by the needle injection. All prime tained by RT-PCR and MSP1 was amplified 19 mice (including vector and PBS controls) ini- by PCR respectively (Fig. 1a, 1b). Both have tially received three immunizations at 2-week the same restriction sites, BamHI and EcoRI. intervals (via IM routes). The product of PCR was purified and digested by restriction enzymes, so as the vector of Challenge infection pVAX1. After gel electrophoresis, purification Blood from an infected mouse with P. berghei and ligation, plasmids were transformed into NK65 was taken and immediately diluted in E. coli DH5α, and positive clone were identi- PBS to give the lethal dosage (2×106 infected fied (Fig. 1c). The recombinant plasmids, RBC per dose). Mice were infected by named pVAX1-ficolin-A and pVAX1- MSP1 , 19 intraperitoneal injection at day 0 (Two weeks were used in the following study. To detect after last immunization). whether the two plasmids can express in euka- ryon, pVAX1-ficolin-A and pVAX1- MSP1 Parasitemia measurements and analyze 19 were transfected COS7 cells, the results sug- Survival time gest both gene express exactly in eukaryon To evaluate the effect of immunization, infec- (Fig. 1d). tion levels were assessed by Giemsa staining of tail smears, and examined by microscopy. The number of newly invaded ring stages was counted, and invasion was expressed as per- cent invasion calculated using the formula I/(I+U)×100, where I is the number of eryth- rocytes infected with ring stages in one visual field, U is the number of uninfected eryt- hrocytes in the same visual field. Fifty fields of views were counted in each smear, then mean value and standard error analyzed by SPSS 13.0. Three mice were selected randomly from each group, and three smears were prepared for each mouse. Parasitemia assessed on day 2, 4, 6, 8, 10, respectively, through the period of crisis of parasitemia. Mice were feed till 30 days, the survival mice were sacrificed and survival time was analyzed used by Kaplan- Fig. 1: Generation and characterization of recom- Meier (SPSS 13.0). binant ficolin-A and MSP1 . (A) Got the gene of 19 ficolin-A by RT-PCR; (B) Amplification the gene Statistical analysis of MSP1 by PCR; (C) Identified the recombinant Data were expressed as mean ± standard de- 19 plasmids, pVAX1- MSP1 and pVAX1-Ficolin-A, 19 viation SD) and analyzed by one-way ANO- lane 1 and 2 respectively, digested by BamHI and VA and q test using SPSS 13.0. A P value less EcoRI. (D) Western blotting analysis the expres- than 0.05 was considered statistically signifi- sion of pVAX1- MSP1 and pVAX1-ficolin-A in 19 cant. COS7 cells, lane 2 and 3 represent MSP1 and 19 ficolin-A proteins respectively Available at: http://ijpa.tums.ac.ir 36 Iranian J Parasitol: Vol. 8, No.1, Jan-Mar 2013, pp. 33-39 Test of inhibition invasion gest both ficolin-A and MSP1 haven’ signifi- 19 To evaluate the ability of ficolin-A anti-infec- cant effect of prolong survival time, compared tion by Plasmodium, the percent of invasion with the group of pVAX1 (P=0.18, P=0.07). erythrocyte by Plasmodium was detected. The But the group of pVAX1-ficolin-A with percent of invasion for five groups were pVAX1-MSP1 has significantly prolong mice 19 counted at 2, 4, 6, 8, 10 day, respectively. At 2, life compared with the group of pVAX1 4 day after infection, the percent of invasion (P=0.01). Although ficolin-A did not exhibit for five groups showed approximate data. At 6, more protection than MSP1 , the data 19 8, 10 day after infection, the percent of inva- showed ficolin-A could enhance the protec- sion were different rapidly, the group of PBS tion of MSP1 (Fig. 3). 19 was 33.9%, 38.33%, 45.34%, the group of pVAX1 was 20.92%, 41.8%, 43.78%, the PBS Vector group of pVAX1-ficolin-A was 13.05%, 8 Ficolin-A 28.78%, 36.15%，the group of pVAX1- MSP119 Ficolin-A+MSP1 19 MSP1 was 3.72%, 21.05%, 33.36%, while the 6 19 group of pVAX1-ficolin-A with pVAX1- e MsuSltPs 1in19d wicaast e3d. 1f6ic%ol,i n1-5A.8 5ca%n, d2e2c.r2e3a%se. PTlhasem roe-- tar laivru4 P=0.01 S P=0.07 dium invasion erythrocyte, but the effect of 2 ficolin–A is less than MSP1- . The percent of 19 P=0.18 invasion sharply decrease when use ficolin-A 0 and MSP1- stand together (Fig. 2). 19 5 10 15 20 25 30 Time(day) PBS Vector Fig. 3: The survival rate was compared with the 50 Ficolin-A )% MSP1 method of Kaplan-Meier (SPSS13.0), five groups ( a Ficolin19-A+MSP1 were compared, PBS, pVAX1, pVAX1-Ficolin-A, im 40 19 etisara 30 pMVSAPX1119.- MSP119, pVAX1-ficolin-A and pVAX1- P fo tn 20 Discussion e c re P 10 Many factors are involved in this burden of malaria, and lack of an effective malaria vac- 0 cine (20). Highly purified protein antigens are 2 4 6 8 10 usually poor immunogens, adjuvants are need- Days after infection ed to obtain satisfactory immune responses. But thus induce draconic security issue for Fig. 2: The percent of invasive Plasmodium was human being. Molecular from organism itself counted on five groups. Mean value and standard which could enhance candidate antigen error was marked on 2, 4, 6, 8, 10 days after infec- immuprotection may overcome the problem. tion, image automatic generation by Origin 6.0 Some component of classics complement pathway such as C5a, were verified contribute Analysis of survival rate to the pathogenesis of placental malaria (PM) To observe the protection effect of ficolin-A, by inducing dysregulated inflammatory and eight BALB/c mouse were sacrificed till 30 angiogenic response that impair placental days after infection. The status was analyzed function (21). And the oligomerization do- by Kaplan-Meier (SPSS 13.0). The results sug- main of C4-binding protein (C4bp) was re- 37 Available at: http://ijpa.tums.ac.ir Chen, Liu et al.: Ficolin-A Enhances Inhibition of the C-Terminal 19 kDa … ported that can play a new adjuvant-like effect, of innate immunity in the acquired immune when it was fused to P. yoelii MSP and sub- response. Science. 1996; 272;50-3. 19 stantially increases the antigen’s immunoge- 3. Matsushita M, Fujita T. The role of ficolins in innate immunity. Immunobiology. 2002. nicity (22). 205;490–7. However, less is known about ficolin-A, 4. Fujita T, Matsushita M, Endo Y. The lectin- whether play an active role in anti-malaria. Al- complement pathway and its role in innate im- though there is no evidence show ficolin-A munity and evolution. Immunol Rev. 2004; stimulate the innate immune system against 198:185–202. malaria, our results indicated ficolin-A can en- 5. Taira S, Kodama N, Matsushita M, Fujita T. hance the immuoprotection of MSP1 (Fig. 2; Opsonic function and concentration of hu- 19 Fig. 3). man serum ficolin/P35. Fukushima J Med Sci. Since ficolins are normal component in organ- 2000; 46:13–23. isms, they could be used as formulation in 6. Kuraya M, Matsushita M, Endo Y, Thiel S, vaccine to avoid unsafe factor caused by adju- Fujita T. Expression of H-ficolin/Hakata anti- gen, mannose-binding lectin-associated serine vant. It provides some evidence that human protease (MASP)-1 and MASP-3 by human ficolins, such as L-ficolin and M-ficolin, can glioma cell line T98G. Int Immunol. be used as available formulation in vaccine to 2003;15:109–17. defend the human infected Plasmodium. How- 7. Pan Q, Chen H, Wang F, Jeza VT, Hou W, ever, we need do more work to understand Zhao Y, Xiang T, Zhu Y, Endo Y, Fujita T, the anti-malaria mechanism of ficolin-A in Zhang XL. L-ficolin binds to the glycoprote- mice, and whether excessive expression of ins hemagglutinin and neuraminidase and in- ficolins in vivo might elicit other autoimmun- hibits influenza A virus infection both in vitro ity damages need further investigation. and in vivo. J Innate Immun. 2012; 4(3):312- 24. Conclusion 8. Fujimori Y, Harumiya S, Fukumoto Y, Miura Y, Yagasaki K, Tachikawa H, Fujimoto D. Molecular cloning and characterization of Our research suggest that ficolin-A can en- mouse ficolin-A. Biochem Biophys Res hance the immunoprotection of MSP1 in 19 Commun. 1998; 244:796–800. vivo, and ficolin-A may be used as immunoen- 9. Ohashi T, Erickson HP. Oligomeric structure hancer in the study of vaccine defending mala- and tissue distribution of ficolins from mouse, ria. pig and human. Arch Biochem Biophys .1998; 360:223–32. Acknowledgements 10. Liu Y, Endo Y, Homma S, Kanno K, Yagi- numa H, Fujita T. FicolinA and ficolin B are expressed in distinct ontogenic patterns and This work was supported by grants from the cell types in the mouse. Mol Immunol. 2005; Open Foundation of the State Key Laboratory 42:1265–73. of Agricultural Microbiology (No. AMLKF20 11. Endo Y, Nakazawa N, Iwaki D, Takahashi M, 1004) and Wuhan health bureau funded pro- Matsushita M, Fujita T. Interactions of ficolin jects (WH12A03). The authors declare that and mannose-binding lectin with fibri- there is no conflict of interest. nogen/fibrin augment the lectin complement pathway. J Innate Immun. 2009; 2(1):33-42. References 12. Facer C A and Tanner M. Clinical trials of ma- laria vaccines: progress and prospects. Adv. Parasitol. 1997;39:1–68. 1. Aregawi M, Cibulskis R, Otten M, Williams R, 13. Good M F. Towards a blood-stage vaccine for Dye C: World Malaria Report 2008 World malaria: are we following all the leads? Nat Health Organization, Geneva 2008. Rev Immunol. 2001; 1:117–25. 2. Fearon DT, Locksley RM. The instructive role 14. Holder AA: The carboxy-terminus of mero- Available at: http://ijpa.tums.ac.ir 38 Iranian J Parasitol: Vol. 8, No.1, Jan-Mar 2013, pp. 33-39 zoite surface protein 1: structure, specific anti- 1996; 157:1176–83. bodies and immunity to malaria. Parasitology. 19. Hirunpetcharat C, Tian JH, Kaslow DC, van 2009;136:1445-56. Rooijen N, Kumar S, Berzofsky JA, Miller LH, 15. Blackman MJ, Heidrich HG, Donachie S, Good MF. Complete protective immunity in- McBride JS, and Holder AA. A single frag- duced in mice by immunization with the 19- ment of a malaria merozoite surface protein kilodalton carboxylterminal fragment of the remains on the parasite during red cell inva- merozoite surface protein-1 (MSP119) of sion and is the target of invasion inhibiting an- Plasmodium yoelii expressed in Saccharomyces tibodies. J Exp Med. 1990;172:379–82. cerevisiae. Correlation of protection with anti- 16. Daly TM, Long CA: A recombinant 15-kilo- gen-specific antibody titer, but not with effec- dalton carboxyl-terminal fragment of Plasmo- tor CD4+ T cells. J Immunol. 1997;159:3400– dium yoelii yoelii 17XL merozoite surface protein 11. 1 induces a protective immune response in 20. Good, M. F. Vaccine-induced immunity to mice. Infect Immun. 1993; 61:2462-7. malaria parasites and the need for novel strate- 17. Ogutu BR, Apollo OJ, McKinney D, Okoth gies. Trends Parasitol. 2005;21:29–34. W, Siangla J, Dubovsky F,Tucker K, Wai- 21. Conroy A, Serghides L, Finney C, Owino SO, tumbi JN, Diggs C, Wittes J, Malkin E, Leach Kumar S, Gowda DC, Liles WC, Moore JM, A, Soisson LA, Milman JB, Otieno L, Holland Kain KC. C5a enhances dysregulated inflam- CA, Polhemus M, Remich SA, Ockenhouse matory and angiogenic responses to malaria in CF, Cohen J, Ballou WR, Martin SK, Angov vitro: potential implications for placental ma- E, Stewart VA, Lyon JA, Heppner DG, With- laria. PLoS One. 2009;4(3):e4953. ers MR; MSP-1 Malaria Vaccine Working 22. Solabomi A. Ogun, Laurence Dumon-Seigno- Group. Blood stage malaria vaccine eliciting vert, Jean-Baptiste Marchand, Anthony A. high antigen-specific antibody concentrations Holder,1 and Fergal Hill. The Oligomerization confers no protection to young children in Domain of C4-Binding Protein (C4bp) Acts Western Kenya. PLoS One. 2009;4:e4708. as an Adjuvant, and the Fusion Protein Com- 18. Tian JH, Miller LH, Kaslow DC, Ahlers J, prised of the 19-Kilodalton Merozoite Surface Good MF, Alling DW, Berzofsky JA, Kumar Protein 1 Fused with the Murine C4bp Do- S. Genetic regulation of protective immune re- main Protects Mice against Malaria. Infec and sponse in congenic strains of mice vaccinated Immun. 2008;76(8):3817–23. with a subunit malaria vaccine. J Immunol. 39 Available at: http://ijpa.tums.ac.ir