Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press METHOD Determination of ribonuclease sequence-specificity using Pentaprobes and mass spectrometry JOANNA L. MCKENZIE,1 JOHANNA M. DUYVESTYN,1 TONY SMITH,2 KATERINA BENDAK,3 JOEL MACKAY,3 RAY CURSONS,1 GREGORY M. COOK,4 and VICKERY L. ARCUS1,5 1DepartmentofBiologicalSciences,2DepartmentofComputerScience,UniversityofWaikato,Hamilton3240,NewZealand 3SchoolofMolecularandMicrobialBiosciences,UniversityofSydney,NSW2006,Australia 4DepartmentofMicrobiologyandImmunology,OtagoSchoolofMedicalSciences,UniversityofOtago,Dunedin9054,NewZealand ABSTRACT The VapBC toxin-antitoxin (TA) family is the largest of nine identified TA families. The toxin, VapC, is a metal-dependent ribonuclease that is inhibited by its cognate antitoxin, VapB. Although the VapBCs are the largest TA family, little is known about their biological roles. Here we describe a new general method for the overexpression and purification of toxic VapC proteinsandsubsequentdeterminationoftheirRNasesequence-specificity.FunctionalVapCwasisolatedbyexpressionofthe nontoxic VapBC complex, followed by removal of the labile antitoxin (VapB) using limited trypsin digestion. We have then developedasensitiveandrobustmethodfordeterminingVapCribonucleasesequence-specificity.Thistechniqueemploysthe useofPentaprobesassubstratesforVapC.TheseareRNAsequencesencodingeverycombinationoffivebases.Wecombinethe RNase reaction with MALDI-TOF MS to detect and analyze the cleavage products and thus determine the RNA cut sites. Successful MALDI-TOF MS analysis of RNA fragments is acutely dependent on sample preparation methods. The sequence- specificity of four VapC proteins from two different organisms (VapC and VapC from Pyrobaculum aerophilum, PAE0151 PAE2754 and VapC and VapC from Mycobacterium tuberculosis) was successfully determined using the described strategy. Rv0065 Rv0617 Thisrapidandsensitivemethodcanbeappliedtodeterminethesequence-specificityofVapCribonucleasesalongwithother RNA interferases (suchas MazF)froma rangeof organisms. Keywords: VapC; toxin-antitoxin;mycobacteria;RNase;RNA interferase;PIN-domain INTRODUCTION The term ‘‘RNA interferase’’ has been given to the VapC toxins, reflecting their biochemical activity as sequence- The Pfam database lists 4089 proteins belonging to the specific RNases. This term also encompasses an unrelated PIN-domain family (PF01850) from 1129 different species TA toxin family, the MazF proteins, that cleaves mRNA (Finn et al. 2010), including eukaryotes, archaea, and pro- (Zhang et al. 2003). karyotes. The VapBC (virulence-associated protein) toxin- The VapBC TAs are the largest family of the nine TA antitoxin(TA)familyaredefinedbytheirtoxiccomponents, families classified (Gerdes et al. 2005; Van Melderen et al. which belong to the PIN-domain protein family. TA pairs 2009), yet they are the least well characterized. Although are arranged as a bicistronic operon (Anantharaman and sequence conservation across PIN-domains is poor, there is Aravind2003),andthetoxingeneencodesastabletoxin (a conservationofthethree-dimensionalstructure,whichresults VapC PIN-domain). The preceding gene encodes a labile in a clustering of acidic residues proposed to constitute the antitoxin (VapB) that bindsto andinhibitsthe activity of active site (Arcus et al. 2011). Of the few VapC/PIN-domain thetoxin.Ingeneral,theantitoxinalsobindstoDNAviaits proteinscharacterized,mostdemonstrateribonucleaseactivity N-terminal domain and interacts with specific sequences (Daines et al. 2007; Miallau et al. 2009; Ramage et al. 2009; within the promoter of the TA operon (Gerdes et al. 1986). Ahidjo et al. 2011). VapC of Shigella flexneri 2a virulence plasmidpMYSH6000andVapCofSalmonellaentericaserovar TyphimuriumT2aresite-specifictRNasesthatcleaveinitiator 5Correspondingauthor. tRNA between the anticodon stem and loop (Winther and [email protected]. Gerdes 2011). VapC6 from Sulfolobus solfataricus targets Articlepublishedonlineaheadofprint.Articleandpublicationdateare athttp://www.rnajournal.org/cgi/doi/10.1261/rna.031229.111. mRNAs involved in the heat shock response (Maezato et al. RNA(2012),18:00–00.PublishedbyColdSpringHarborLaboratoryPress.Copyright(cid:2)2012RNASociety. 1 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press McKenzieet al. 2011), and VapC from nontypeable Haemophilus influenzae degrades free RNA in vitro but not double-stranded (ds) DNAorsingle-stranded(ss)DNA(Dainesetal.2007).VapC-5 from Mycobacterium tuberculosis displays Mg2+-dependent ribonuclease activity (Miallau et al. 2009), although the catalytic mechanism or sequence-specificity of these en- zymeshasnotbeendetermined.AlthoughFitBfromNeisseria gonorrhoeaestructurallyresemblesVapC ,itsribonucle- PAE2754 ase activity has not been characterized due to an inability to express soluble recombinant protein (Mattison et al. 2006). Ithas,however,beenshowntomediateintracellulartraffick- inginvivo(Hopperetal.2000).PIN-domainproteinsfrom eukaryotes are associated with nonsense mediated decay (NMD) of RNA (Huntzinger et al. 2008) and processing of pre-18S rRNA fragments (Lamanna and Karbstein 2009). An important step to understanding the function of VapC and the PIN-domain proteins is the biochemical elucidation of their RNase sequence-specificity. We have previouslydemonstratedribonucleaseactivityforVapC Rv0065 and VapC from M. tuberculosis (Ahidjo et al. 2011). Rv0617 Here,wedescribea detailedprotocolforthe purification of VapC from two organisms and the determination of VapC sequence-specificity as a first step in identifying the bi- ologicalsubstrateforVapCenzymes(Fig.1).Therearetwo significant hurdles in the biochemical characterization of VapC:expressionandpurificationofVapC(inmanycases, a very toxic protein) and determination of the target RNA sequence.Toovercomethefirsthurdle,wehavedeveloped an approach to overexpress and purify the inactive VapBC complex and then isolate VapC alone, from this complex. ThiscircumventstherequirementtoexpressthetoxicVapC alone, which has previously been shown to be problematic (Mattison et al. 2006; Miallau et al. 2009; Ramage et al. 2009). To overcome the second hurdle, we have developed a ribonuclease assay usingsynthetic substrates and MALDI- TOF mass spectroscopy (MS). Although determining general ribonuclease activity is straightforward, there are few methods for elucidation of sequence-specificity. The most common method used is FIGURE 1. Schematic diagram of VapC purification, sequence- primer extension (Zhang et al. 2003; Zhu et al. 2009; Han specificity, and kinetic analysis. To neutralize VapC toxicity it is ex- pressedincomplexwithVapB.ProteolyticlysensitiveVapBisremoved etal.2010).Alternatively,RNAtranscriptsofspecificgenes bytrypsin,andVapCispurifiedbyanionexchangechromatography. can be assayed and cleavage sites determined by labeling RNaseactivityandsequence-specificityarescreenedusingPentaprobes the assay products with a radioactive isotope such as 32P (ticks indicate Pentaprobes cut by all VapC proteins tested; crosses (Munoz-Gomezetal.2004;Fuetal.2007).However,these indicatePentaprobesnotcut).ShortRNAoligonucleotidesaredesigned basedonthePentaprobeRNAcleavedbyallVapCproteinsandcutsites approaches require prior knowledge of a bona fide target determined by MALDI-TOF MS and in-house software. A fluorogenic mRNA and/or use the viral MS2 RNA as a substrate. We RNAsubstratewithasinglecutsiteisthendesignedfordetermination have developed a new rapid ribonuclease activity assay for ofVapCkineticparameters. sensitivedeterminationofthesequence-specificityofVapC proteins. Identification of VapC target sequences allows de- termination of possible in vivo substrates for VapC. This equalnumberofeachbase),itformsanextensivesecondary newapproachemploystheuseofPentaprobesinsteadofthe structure, requiring the use of CspA (a major cold shock commonly used MS2 bacteriophage RNA (Zhu et al. 2006; protein from Escherichia coli) as an RNA chaperone (Jiang Ramageetal.2009).AlthoughMS2RNAiscomplexenough et al. 1997). The Pentaprobes were generated using a com- todeterminecleavagesiteslongerthanthreebases(i.e.,MS2 puter algorithm that determined the minimum sequence RNAis3569basesin lengthandcontainsanapproximately requiredtocovereverycombinationoffivebases—516base 2 RNA,Vol. 18,No.6 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press Determination ofVapC sequence-specificity pairs(Kwanetal.2003).Thissequencewasthenencodedin Expression of VapC from M. smegmatis as a MSMEG_1284 sixoverlappingdsDNAmoleculesfromwhichRNAcanbe His-tagged fusion protein in E. coli gave insoluble protein. transcribed, resulting in 12 ssRNA segments (six in the However, expression ofVapC asa maltose bind- MSMEG_1284 forward direction and six complementary sequences in the ing protein (MBP) fusion in E. coli greatly increased the reverse direction)covering every combination of five bases solubility of VapC. This approach was reported by Ramage (Bendaketal.2012).ThereversePentaprobesequencesalso etal.(2009)fortheexpressionofM.tuberculosisVapCpro- allow dsRNA to be synthesized. The use of Pentaprobe teins. Wheninthe contextofa fusionprotein, MBP actsas RNA,whichisshorterthanthecommonlyusedMS2RNA, ageneralmolecularchaperoneandpromotesproperfolding reduces the amount of secondary structure present in the of the attached protein (Kapust and Waugh 1999). MBP RNA substrate (negating the need for an RNA chaperone) mostprobablypreventsdimerizationofVapC,therebyabol- while still allowing screening of recognition sequences up ishing its activity and its toxicity to the cell and enabling tofivebases.OtheradvantagesofthePentaprobeplasmids soluble protein expression. Although we found MBP-VapC are that dsDNA, ssDNA, dsRNA, and ssRNA can be syn- inthesolublefractionoftheE.colilysate,thefusionprotein thesized and that biochemical activity is tested against all elutesinthevoidofasize-exclusioncolumn,indicatingthat substrate types. it forms large soluble aggregates. Further, proteolytic cleav- Although there have been reports of MALDI-TOF MS age of MBPfromVapC was notpossible,perhapsasacon- being used for analysis of RNA up to 461 nucleotides (nt) sequence of this aggregation (data not shown). (Kirpekar et al. 1994), mass resolution decreases dramati- In contrast, the VapBC complex is inactive and thus callywithincreasingoligonucleotidesize.Thereforetodeter- moreamenabletooverexpression(Robsonetal.2009).Itis mine the RNase sequence-specificity, we designed short awell-knownfeatureofTAsystemsthattheantitoxinisless overlapping RNA oligonucleotides based on the targeted stableandmoresusceptibletoproteolyticdegradationcom- Pentaprobe sequence (Fig. 1). These short RNAs were cut pared with the toxin (Gerdes et al. 2005). To exploit these and analyzed using MALDI-TOF MS. The use of RNA differentpropertiesofVapBandVapC,theproteasetrypsin oligonucleotidesandMALDI-TOFMSnegatestheneedfora was used to digest away VapB from several recombinant reversetranscriptase.MSprovidesafast,sensitive,anddirect VapBC complexes. Thus the mycobacterial VapC proteins wayofanalyzingtheproductsofribonucleaseactivityassays. VapC and VapC (from M. tuberculosis) were Rv0065 Rv0617 OncethespecificityofVapCwasknown,detailedkinetic isolated by digestion of their cognate VapBC complexes analyses were carried out using a sensitive fluorometric sub- with 0.1 mg/mL trypsin and subsequent anion exchange strate similar to that of the method described by Kelemen purification (Fig. 2). The protease reaction was stopped by etal.(1999)andWangandHergenrother(2007)forquantita- theadditionof0.1mg/mLtrypsininhibitor(fromSoybean tion of VapC activity and kinetic analyses of these enzymes. max)beforepurification.MALDI-TOFMSofthedigestion This approach is fast, robust, and general and can be mixture,followingpurificationofVapCbyanionexchange combined with results from biological assays to link the chromatography, showed two masses corresponding to in vitro and in vivo activities of this large and important VapC with and without the C-terminal His-tag (Fig. 2). family of enzymes. It is also amenable to other sequence VapC and VapC (from the crenarchaeon PAE2754 PAE0151 specific RNases such as the MazF family of RNases. Pyrobaculum aerophilum) can be overexpressed in E. coli (Arcus et al. 2004; Bunker et al. 2008) with no toxicity problems as seen for other VapC proteins. This is most RESULTS AND DISCUSSION probably aresult oftheir verylowsolubility at neutral pH. Using a lysis buffer at pH 9.2 resolubilizes VapC from the Expression and purification of VapC cell lysate. VapCproteinsaregenerallytoxicanddifficulttooverexpress. WesurveyedarangeofapproachestooverexpressVapC.For Screening for VapC sequence-specificity example, initial attempts to express VapC in its MSMEG_1284 using Pentaprobes native host Mycobacterium smegmatis were unsuccessful due to its toxicity. Following induction, no VapC protein was The 12 Pentaprobe vectors can be used to make ss and ds detected on an SDS-PAGE gel, and sequencing of the VapC RNA and DNA substrates that encode every combination expressionconstructrevealeda2-bpinsertionthatwasnot of five bases (Bendak et al. 2012). We have demonstrated present prior to transformation (resulting in a nonsense ribonuclease activity for VapC and VapC using Rv0065 Rv0617 stop-codon downstream), explaining the absenceofVapC one of the ss Pentaprobe RNA substrates (Ahidjo et al. protein expression in this case. This mutation presumably 2011). Here we describe a detailed protocol for determi- arisesinresponsetobasalexpressionoftoxicVapCfromthe nation of the sequence-specificity of RNases and use this leaky T7 promoter before induction and a requirement to approach to determine the sequence-specificity of two escapefromthistoxicexpressioninorderforthebacteriato VapCs from M. tuberculosis and two from P. aerophilum. grow. Figure3illustratestheuseofPentaprobeRNAsforscreening www.rnajournal.org 3 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press McKenzieet al. VapC andVapC exhibit PAE0151 PAE2754 no nuclease activity against dsRNA, ssDNA, and dsDNA, although they had been shown to cleave the ssRNA equiv- alent to the same sequence. Identification of the VapC target sequence VapC , VapC , VapC , PAE0151 PAE2754 Rv0065 andVapC allcleave932Pentaprobe Rv0617 RNA. Therefore, a set of short over- lapping oligonucleotides covering 932 Pentaprobe RNA could be used as sub- strates for VapC , VapC , PAE0151 PAE2754 VapC , and VapC . Ribonucle- Rv0065 Rv0617 ase activity of VapC was tested against these short RNA oligonucleotides, and MALDI-TOFMSwasusedtoidentifythe RNAcutsites.MALDI-TOFMSisacon- venient tool for the analysis of many complex mixtures and is well suited to analysis of RNA molecules (during the ionizationprocessDNAispronetoloss of bases, whereas RNA is more stable) (Nordhoff et al. 1993). Sample prepa- rationiscrucialforMALDI-TOFMSas chemicals commonly used in biochem- ical assays such as EDTA, glycerol, and MgCl can reduce sample ionization; 2 RNA also forms adducts with sodium andpotassiumions(Shaleretal.1996), which decreases mass accuracy. It is therefore crucial for the sample to be de- salted before MALDI-TOF MS analysis. FIGURE 2. Purification and isolation of VapC. (A) The VapBC complex Rv0065a-Rv0065 fromM.tuberculosisexpressedinM.smegmatiselutesasasinglepeakonanS200sizeexclusion Avarietyofdesaltingtechniqueswere column. (B) Thecorresponding SDS-PAGE gelshows the presence ofbothVapBandVapC trialed and assessed for their ability to proteins in the complex. (C) Trypsin digestion of the VapBC complex followed by anion minimize impurities, reduce adducts, exchangechromatography.Duetodifferencesintheirisoelectricpoints,trypsiniselutedearly from the column while VapC is eluted later in the NaCl gradient. (D) Corresponding SDS- andmaximizesamplerecovery.AllVapC PAGEgeldemonstratesthetrypsindigestofVapBCloadedontothecolumn(LOAD)andthe proteinstestedrequiredNaClandMgCl 2 presenceofVapCwithandwithouttheC-terminalHis-tag. for activity. The use of cation exchange beads loaded with ammonium ions to ofVapCsequence-specificity.VapC andVapC exchangeoutthesodiumionswasonlymoderatelysuccess- PAE0151 PAE2754 aresequence-specificandtargetthesamesequenceasshown ful;sodiumion adductswerestill present upon MSanalysis by the same cleavage pattern for the 924 Pentaprobe RNA (datanotshown).C reverse-phasepipettetips,alsoknown 18 (Fig. 3). VapC and VapC target a different se- as ZipTips resulted in cleaner RNA, but the majority of Rv0065 Rv0617 quence on the same 924 Pentaprobe substrate (Fig. 3). The the sample was lost in the process. Both lithium chloride sequence-specificityofVapC ,VapC ,VapC , andethanolprecipitationandsodiumacetateandethanol PAE0151 PAE2754 Rv0065 and VapC also differ from that of VapC , precipitation of RNA cleavage products were moderately Rv0617 MSMEG_1284 which does not cut the 924 Pentaprobe RNA (the sequence- successful approaches in precipitating small pieces of RNA, specificity and biological role of VapC are pub- although some sample was still lost in the process and the MSMEG_1284 lished elsewhere) (McKenzie et al. 2012). VapB in complex useofsodiumacetatedidnotremovesodiumadductsfrom with VapC inhibits its RNase activity as shown in Figure 3 the RNA. (theVapBCcomplexPAE2754/PAE2755couldnotbetested Ammonium acetate and ethanol precipitation of assay due to the insolubility of VapB upon expression). reactions resulted in maximum sample recovery, and the 4 RNA,Vol. 18,No.6 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press Determination ofVapC sequence-specificity positioneddirectlybeforethecleavagesite,whereasthere is some redundancy for the bases present at other positions in the target sequence (Fig. 4C). VapC and VapC cleaved almost all of the Rv0065 Rv0617 short 932-based RNA oligos but with varying efficiency; analysis of the cleavage products for one of these short oligosbyMALDI-TOFMS(Fig.5A)revealedthatVapC Rv0065 and VapC cut GC-rich 4mers, i.e., GGCG, GCCG, Rv0617 andGGGC(Fig.5B).Analysisofthecleavagesitesacrossall the RNA oligos cut by these two VapCs confirmed that VapC and VapC target GC-rich sequences (Fig. Rv0065 Rv0617 5C). As with the other VapC proteins characterized in this study,thereisredundancyinthetargetsequenceandVapC will cleave a range of sequences less efficiently (Fig. 5C). Table1liststheVapCproteinscharacterizedtodateand FIGURE3. VapCproteinsRv0065,Rv0617,PAE0151,PAE2754display the range of sequence targets for these RNase enzymes. sequence-specific, Mg2+-dependent ribonuclease activity. VapC PAE0151 VapC and VapC cut GC-rich 4-mers, and and VapCPAE2754 appear to target the same sequence as seen by the Rv0065 Rv0617 sameRNAfragmentsonthegels;thisisalsoseenforVapC and VapC and VapC cut the G-rich sequences Rv0065 PAE0151 PAE2754 VapCRv0617, which also appear to target the same sequence. Negative GGUG and GGGG. With all four proteins characterized to controls (RNA only at 0- and 60-min time points) show no ribonu- date,thereisredundancyinthetargetsequences,inthatthey clease contamination; 12 mM EDTA (E) inhibits VapC activity, and will cleave other sequences, albeit at a lower rate. VapC when in complex with VapB (C) displays no ribonuclease ac- tivity. This lane is missing from the VapC panel as VapBC Determination of the specific RNA sequence motif that PAE2754 cannotbeproducedinthiscaseduetotheinsolubilityofVapB.Ladder istargetedbyVapC proteins isjustthefirststepinfinding indicatessizesofRNA. the biologically relevant target. It is likely that the biologi- cally relevant target is a combination of sequence and RNA samplesweremore amenable toMALDI-TOFMSanalysis. secondarystructure.However,theidentificationofthetarget ThismethodwassuccessfulforVapC andVapC sequence is an important first step to characterizing the PAE0151 PAE2754 assaysastheseareconductedinaTris-HClbuffer.VapC biological activity of individual VapC RNases. Rv0065 and VapC assays were conducted in a sodium phos- Rv0617 phate buffer giving rise to sodium adducts on the RNA. Precise bonds cut by VapC However, these VapC proteins demonstrated equivalent ac- tivityinanammonium phosphate buffer. MALDI-TOFMS MALDI-TOF MS analysis also provides insight into the data were analyzedusing in-housesoftware thatscannedall molecular mechanism of VapC RNase activity. The precise peaks and matched these with theoretical masses generated masses of the RNA cleavage products from VapC , PAE2754 from the known oligonucleotide sequences. VapC , VapC , and VapC reactions reveal PAE0151 Rv0065 Rv0617 ThiscombinationofPentaprobesandMALDI-TOFMSof a 59 phosphate present on the 39 cleavage product. This oligonucleotidesbasedonaPentaprobeRNAallowedusto contrasts with the reported mechanism of the MazF and readily characterize the sequence-specificity of VapC from PemK (Kid) toxins, as well as that recently described for the two organisms. VapC and VapC cleaved VapC from S. flexneri and VapC from S. enter- PAE0151 PAE2754 pMYSH6000 LT2 short RNA oligos based on the 932 Pentaprobe. Figure 4 ica. These enzymes have all been reported to cleave the showstheMALDI-TOFspectraofthecleavageproductsfrom phosphodiester bond to yield a free 59 OH group on the 39 a short 932-based oligo after incubation with VapC cleavageproduct,anda29-39cyclicphosphateonthe39end PAE0151 orVapC .After5min,alargeproportionoftheRNA of the 59 cleavage product, similar to RNase H (Munoz- PAE2754 oligo is degraded, and after 60 min, all of the oligo is Gomez et al. 2005; Zhang et al. 2005; Winther and Gerdes degradedand thehigher-molecular-weight RNA fragments 2011). are also being degraded (Fig. 4A). This result suggests that Our MALDI-TOF MS data are consistent with other there is an optimal recognition sequence for VapC metal-dependent ribonuclease enzymes that activate a PAE0151 and VapC and that other suboptimal sequences are water molecule to initiate nucleophilic attack and cleave PAE2754 alsorecognizedforcleavage(Fig.4B).Figure4Csummarizes the 39-O-P bond of RNA to produce 39 hydroxyl and 59 thecleavagesitesofVapC andVapC acrossall phosphate cleavage products (Tadokoro and Kanaya 2009). PAE0151 PAE2754 theshortoligostested.TheMALDI-TOFMSresultsinFigure4 Future work to establish the exact catalytic mechanism confirmedthatthesetwoproteinstargetthesamesequence of VapC/PIN-domain proteins and the determinants of and revealed the optimal cut site to be GG*UG, and also the sequence-specificity will allow prediction of the RNA showed a less optimal cleavage site at GG*GG (Fig. 4C). sequencestargetedby eachmember ofthislarge family of Overall, it can be seen that a guanine residue is always proteins. www.rnajournal.org 5 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press McKenzieet al. FIGURE 4. VapC and VapC target GGUG and GGGG sequences. (A) MALDI-TOF MS of 932 RNA oligonucleotide five PAE0151 PAE2754 negativecontrols(RNA0and60minandEDTA)shownodegradationoftheRNAoligonucleotideduetoribonucleasecontamination.Time courseassaysofVapC (rightpanel)andVapC (leftpanel)showverylittleactivityafter1minat37°CwithVapC.After5min,acut PAE0151 PAE2754 site at GGUG (red fragments in B) is observed with other less optimal cut sites appearing later in the time course (15–60 min; black fragmentsinB).(B)932RNAoligonucleotidefivewithcorrespondingcutsitesandm/zvalues;dottedlinesrepresentfragmentsthatwere belowtheMSdetectionlimit.(C)AnalysisofVapCcleavagesitesacross932RNAoligonucleotidesascalculatedbyWebLogo(Crooksetal. 2004). The VapC cleavageposition is indicatedby an arrow. Theheight of theletter is proportional to thefrequency ofthat baseat that particularposition. Kinetic analysis of VapC VapC displayed no activity against a short, chi- PAE2754 meric (ssDNA/RNA) oligonucleotide in which the cut site Fluorogenicsubstrateshavepreviouslybeenusedtoana- GGUGwasflankedbysixtosevenDNAbasesoneachside lyze the reaction kinetics of ribonucleases (Park et al. (data not shown). This protein did, however, cleave the 2001; Wang and Hergenrother 2007) and generally con- RNAequivalentofthechimericoligonucleotide,suggesting sist of single RNA bases flanked by short DNA se- thatflankingRNA(butnotDNA)sequencesarerequiredfor quences. These mixed oligonucleotides are labeled with catalysis. A substrate consisting of GGUG surrounded by a fluorophore at one end and a quencher at the other. randomizedA,C,andUresidueswasdesignedtohaveonly When the fluorophore and quench are in close proxim- one cleavage site (Fig. 6A,B) for VapC (eliminating PAE2754 ity, a small amount of fluorescence is observed. Upon secondary cleavage). We added a fluorophore (6-FAM) cleavageofthesubstrate,thefluorophoreandquenchare tothe59endofthissequenceandaquencher(IBkFQ)to no longer in close proximity, resulting in an increase in the 39 end, so that cleavage could be monitored by an fluorescence. Based on this concept, we have developed increase in fluorescence at 518 nm. This strategy allowed a sensitive, continuous fluorometric assay to measure determination of the Michaelis-Menten kinetics for VapC activity. VapC (Fig. 6C). PAE2754 6 RNA,Vol. 18,No.6 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press Determination ofVapC sequence-specificity CONCLUSIONS We have developed a simple, effective, and general method for the isolation of toxicVapCproteinsthatcanbeapplied to VapBC complexes from a range of organisms. Expression of soluble VapC from mycobacteria was only possible when in complex with their cognate antitoxins using M. smegmatis as an expression host. Then utilizing the in- herentpropertiesofVapBandVapC,the proteasetrypsincanbeusedtodigestthe less stable VapB, leaving active VapC. VapCcanbesubsequentlypurifiedfrom trypsin using anion exchange chroma- tography. This approach can be used routinely for VapBC complexes from M. tuberculosis. The use of Pentaprobes and MALDI- TOF MS provides a new, robust method for determination of VapC sequence- specificity. Pentaprobes provide identifi- cation of cut sites of up to five bases in RNA molecules of shorter length, re- ducing the amount of secondary struc- ture in the substrate. Shorter RNA oli- gonucleotides can then be designed to mimic regions of the whole Pentaprobe molecule and analyzed by MALDI-TOF MStodeterminesequence-specificity.The sensitivity of this technique allows deter- minationofthepositionofthephosphate moiety on the cleavage products and is useful for elucidation of RNA cleavage mechanisms. This method has been ap- plied to four VapC proteins from two different organisms, identifying different cleavage sites for different proteins, out- lining the effectiveness and versatility of the method. The results presented here point to anumberofpossiblebiologicalrolesfor thevapBCoperonsindisparatebacteria. The G+C content of the two organisms considered in this work (51% for P. aerophilumand66%forM.tuberculosis) FIGURE5. VapC andVapC targetGCsequences.(A)MALDI-TOFMSof932RNA suggests that the RNA target sequences Rv0065 Rv0617 oligonucleotidethreenegativecontrols(RNA0and60minandEDTA)shownodegradation for the VapC proteins (Table 1) are re- of the RNA oligonucleotide due to ribonuclease contamination. Time course assays of latively common among the transcripts VapC and VapC show optimal cut sites at GCC and GGG (indicated by red Rv0065 Rv0617 fragmentsinB).Otherlessoptimalcutsitesappearlaterinthetimecourse(15–60min;black fromeachorganism.Thispointstoward fragments in B). (B) 932 RNA oligonucleotide three with corresponding cut sites and m/z VapCs acting as global down-regulators values;dottedlinesrepresentfragmentsthatwerebelowtheMSdetectionlimit.(C)Analysisof of mRNA transcripts under conditions VapCcleavagesitesacross932RNAoligonucleotidesascalculatedbyWebLogo(Crooksetal. where VapC is free of its cognate in- 2004).VapCcleavagepositionindicatedbyarrow.Theheightoftheletterisproportionalto thefrequencyofthatbaseatthatparticularposition. hibitor VapB. It also seems likely that www.rnajournal.org 7 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press McKenzieet al. M. tuberculosis (Arcus et al. 2011). In- TABLE1. Sequence-specificityofVapCscharacterized tuitively,onemightexpectthatdistantly Pentaprobes 932RNA related VapCs would target unique sub- VapCORF Organism cut oligonucleotidescut Sequence-specificity sets of RNA molecules. However, the PAE0151 P.aerophilum 922 3–6 GG(U/G)G evidence presented here suggests other- 923 wise. Thisaddsweighttothe hypothesis 924 that VapCs in M. tuberculosis are in- 925 volved in global control of RNA in the 927 cell under conditions where VapC is 932 PAE2754 P.aerophilum 922 3–6 GG(U/G)G mobilized. This mobilization may be 923 duetotheup-regulation ofcellularpro- 924 teases under specific conditions that 925 wouldreadilydegradeVapBandliberate 927 VapC inside the cell. 932 Rv0065 M.tuberculosis 922 1–7 (G/C)G(G/C)(G/C/A) 923 MATERIALS AND METHODS 924 925 VapC /VapC and VapC PAE0151 PAE0152 PAE2754 926 wereexpressedandpurifiedaccordingtothe 927 method described previously by Bunker 932 et al. (2008) and Arcus et al. (2004), re- Rv0617 M.tuberculosis 922 1–7 (G/C)G(G/C)(G/C/A) spectively. VapBC complexes Rv0065a- 923 Rv0065andRv0617a-Rv0617werecloned 924 925 into pYUB28b according to the method 926 described by Ahidjo et al. (2011) and 927 expressed for the VapBC complex from 932 M. smegmatis according to the method de- scribedbyRobsonetal.(2009). The Pentaprobes cut by each VapC vary with each ORF. The 932 RNA oligonucleotides cleavedbyeachVapC(932RNAoligoscut)wereusedtodeterminesequence-specificityof Cloning of vapC each enzyme. VapC characterized to date from the same organism exhibit the same MSMEG_1284 sequence-specificity. into pYUB1049 Theopenreadingframe(ORF)encodingthe vapC (MSMEG_1284) gene was amplified VapC will recognize not only sequence but also RNA sec- from M. smegmatis genomic DNA using primers engineered to ondary structure as a determinant of specificity, and this contain an NcoI restriction site (underlined) in the forward addsanotherlayerofcomplexitytothedeterminationofthe primer(TAGCTGCCATGGTTATCGACACTTCTGC)andaBamHI cellular targets of VapC. Winther and Gerdes (2011) have restriction site (underlined) in the reverse primer (TATTTA GGATCCGCGTGGACCGCAGCG). The amplified products recently shown that VapC from enteric bacteria specifically were digested, purified, and ligated into the pYUB1049 shuttle cleaves initiator-tRNA (presumably via a combination of vector, enabling expression with a C-terminal His-tag. The con- sequence and secondary structure), affecting global trans- struct was transformed into E. coli TOP10 cells and sequenced to lation when VapC is dissociated from VapB. The target ensure correct insertion. After sequencing, the constructs were sequences that we have identified rule out initiator-tRNA transformed into M. smegmatis mc24517 electrocompetent cells asatargetfortheVapCproteinsfromP.aerophilumandM. andpositivecoloniesselectedbyplatingthetransformantson7H10 tuberculosis; however, it does not rule out VapC targeting agar media supplemented with ADC (albumin, dextrose, catalase tRNA molecules at other sites. Thus, our working hypo- supplement), 0.05% (w/v) Tween 80, and 50 mg/mL kanamycin thesis isthat VapC targetsa combination ofRNA sequence andhygromycinB. and secondary structure, down-regulating specific RNA transcripts (or tRNA) in response to stress and thereby Protein expression and purification using acting as post-transcriptional regulators of metabolism. Mycobacterium smegmatis as a host Furtherinvivoexperimentsarerequiredtodeterminethe Small-scaleexpressiontestswereusedtoscreenforexpressionof precise cellular targets for the VapCs from P. aerophilum VapCinM.smegmatis. Asingle transformedcolony wasselected and M. tuberculosis. and used to inoculate a PA-0.5G/Tween 80 seeder culture and It is intriguing that VapC and VapC target Rv0065 Rv0617 grown for 48 h at 37°C and diluted (1:100) into a ZYP-5052/ the same RNA sequence. These two proteins are only dis- Tween80expressionculture.Theexpressionculturewasgrownat tantly related, sharing just 22% sequence identity. These 37°C, andaliquotsof cultureweretakenat24, 48,and96h and VapCproteinsarepartofanarrayof46VapCproteinsin pelletedbycentrifugation.Cellpelletswereresuspendedin200mL 8 RNA,Vol. 18,No.6 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press Determination ofVapC sequence-specificity Plasmids were extracted by the alkaline lysis method and sequenced using T7 for- ward and reverse primers to investigate the absence ofVapCexpression. Cloning of vapC into MSMEG_1284 pMAL-c2x TheORFencodingthevapCgene(MSMEG_ 1284) was amplified from M. smegmatis ge- nomic DNA using primers engineered to containanEcoRIrestrictionsite(underlined) intheforwardprimer(CTAGAATTCATGGT TATCGACACTTCTG) and a BamHI restric- tionsite (underlined)in the reverse primer (TATGGATCCTCAGTGGACCGCAGC).The amplifiedproductswerethendigested,puri- fied, and ligated into pMAL–c2x, enabling expressionof aMBP-VapCfusionprotein. The construct was then transformed into E. coli BL21 (DE3) electrocompetent cells and plated on LB agar medium supple- mented with100mg/mLampicillintoselect for positive transformants. Constructs were sequencedtoensurecorrectinsertion. Protein expression and purification of MBP-VapC MSMEG_1284 fusion protein A singletransformedcolonywas usedtoin- oculate a rich media + glucose culture sup- plementedwith100mg/mLampicillin,which was then grown for 24 h at 37°C and was used at a 1:100 dilution to inoculate a rich media+glucoseexpressioncultureandgrown at37°CuntilanOD ofz0.5wasreached. 600 Protein expression was then induced with 0.3mMIPTG,andcellswereincubatedfor a further 2 h at 37°C for maximal protein expression. E. coli expression cultures were pelleted by centrifugation prior to resuspension in 50mM phosphatebuffer (pH 7.4) 200mM NaCl, and 1 mM EDTA and lysed by son- ication. The cell lysate was centrifuged at 16,000g for 20 min to separate the soluble andinsolublefractions.Thesolublefraction FIGURE6. DesignofafluorometricsubstratefordeterminationofMichaelis-Mentenkinetics containing the MBP-VapC fusion protein of VapC . (A) MALDI-TOF spectra of RNA oligonucleotide cleavage and (B) RNA PAE2754 wasloadedontoaHiTrapMBPcolumn(GE oligonucleotide sequence showing only one cleavage site. (C) Reaction velocities were de- Healthcare). The column was washed with terminedfromthe slopesofthe fluorescent datasetsand the calibrationplot. The Michaelis- Mentenequationwas fit tothedatafor substrate concentrations 0.25–7.5mM.(D)Fromthe lysis buffer, and bound proteins were re- curvefitVmax,K andk werecalculated. movedinasingleelutionstepwith5mLof M cat elution buffer (50 mM phosphate buffer at pH7.4,200mMNaCl,1mMEDTA,10mM lysis buffer (50 mM phosphate buffer at pH 7.4, 200 mM NaCl, maltose). Fractions containing the desired protein were analyzed 20mMimidazole).Thecellswerethenlysedbysonicationandthe by SDS-PAGE and subjected to either size exclusion chromatog- lysate centrifuged at 13,000g for 20 min to separate soluble and raphy or Factor Xa cleavage to remove the MBP protein from insoluble fractions. Samples were analyzed by SDS-PAGE for VapC.Aninitialevaluationoffusionproteincleavagewascarried protein expression. outusingFactorXaat1%,2%,and3%(v/v)ofthefusionprotein. www.rnajournal.org 9 Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press McKenzieet al. The reaction mixture was incubated for 2, 4, 6, or 24 h at room 7. Samples are analyzed on a MALDI-TOF mass spectrometer temperature(22°C)with shakingat300 rpm.Lowconcentrations (Bruker Daltonics) inlinear mode. Laser power istypically at of SDS (0.01% and 0.05% [w/v]) were added to help improve z60%, but this can change depending on the ionization re- cleavageofMBP. quirements of the sample. The mass range selector is set to low range, and a range of 2–12 kDa is collected (dependent onsizeoftheoligonucleotide).Theinstrumentisfirstcalibrated Protocol for determining VapC ribonuclease activity withanoligonucleotidecalibrationstandard(BrukerDaltonics) and sequence-specificity using an automatic polynomial correction before analysis of 1. The Pentaprobe insert is PCR amplified using pcDNA3 samples. forward (AGAGAACCCACTGCTTACTGGCT) and reverse 8. Spectra are saved and exported to the DataAnalysis software (AGCGAGCTCTAGCATTTAGGTGACA) primers flanking (Bruker Daltonics), peaks identified and labeled, and the the insert to include the T7 promoter. Pentaprobe RNAs baseline subtracted. aretranscribedfromthegelpurifiedPCRproductusingthe 9. The mass list and corresponding intensities are exported into T7 MEGAscript kit (Ambion) and purified by sodium acetate a comma separated excel file. The data are then processed andethanolprecipitation. using in-house software to determine possible cut sites. The 2. OnemicroliterofpurifiedVapC(1mg/mL)isincubatedwith intensitycutoffwassettomorethan1400soallpeaksabove 1 mg of each Pentaprobe RNA for 60 min at 37°C in the 1400 intensity will be picked for analysis. The software de- presenceof6mMMgCl .6Timepointsaretakenandstopped termines the difference between the predicted mass of the 2 by the addition of formamide loading dye and heated for oligonucleotide and theactual value asmeasured byMALDI- 5 min to 70°C. Negative controls include the omission of TOFMS.Thefragmentswiththeclosestmatchingmasseswill VapC (RNA only), the addition of 12 mM EDTA, and the determine thecut site. additionof1mLVapBCcomplex(1mg/mL)insteadofVapC. Samplesareanalyzedon10%urea-denaturingpolyacrylamide Kinetic analysis of VapC PAE2754 gelspost-stainedwithSYBRGreenIIRNAstain(Invitrogen). 3. Overlapping RNAoligonucleotides aredesigned to model the Fluorogenicsubstratedesign PentaprobeRNAthattheVapCproteinsofinterestcleaveand A chimeric RNA/DNA oligonucleotide was designed with four mimic the secondary structures of the equivalent regions on RNAbasesflankedbyDNA(59-TAAGTCrGrGrUrGACATCAG-39) thewhole Pentaprobe RNA. andtestedforribonucleaseactivitybyMALDI-TOFMSasperthe 4. Assay reactions containing 1 mL purified VapC (1 mg/mL) is protocol above. The RNA oligonucleotides UAAGUCGGUGA incubated with1mgofeachRNAoligonucleotide for60min CAUCAG and CUAAUCGGUGACUACA were tested for single at 37°C in the presence of 6 mM MgCl in a final volume of 2 cut sites by MALDI-TOF MS as above. The CUAAUCGGUGA 10mL.Assayreactionsarestoppedbyadditionof5Mammo- CUACA oligonucleotide labeled with 6-FAM (6-carboxyfluorscein nium acetate (final concentration, 2 M) and three times the fluorophore)atthe59endandIABkFQ(iowablackflurophore reactionvolumeof100%ethanolandthenchilledonicefor quencher) at the 39 end was ordered from Integrated DNA the remainder of the experiment (at least 30 min). The pre- Technologies (IDT) along with the cleavage products, 6-FAM- cipitatedRNAfragmentsarecentrifugedat13,000gfor25min CUAAUCGG and UGACUACA-IABkFQ. at 4°C to pellet the RNA, and the pellet is washed with 70% ethanolandthenresuspendedin10mLnucleasefreewater(not Calibration plot DEPCtreated) 5. MatrixforMALDI-TOFMSispreparedfreshandconsistsof5 Reactions containing a 1:1 molar ratio of the labeled 59 and 39 mg 3-hydroxypicolinic acid (3-HPA), 10 mL 2.5 M diammo- cleavageproductsatvariousconcentrations(0.1,0.25,0.5,1,1.25, niumcitrate,125mLacetonitrile(ACN),and365mLnuclease 1.5mM),12mMTris-HCl,12mMNaCl,6mMMgCl ,to300mL 2 free water. The solution is vortexed well until all matrix is with nuclease free water were equilibrated to 37°C. Fluorescence dissolved and thencentrifuged at13,000gfor 5 min. was measured as described above for 100 sec. Fluorescent values 6. Onemicroliterofmatrixsolutionisspottedontoeachspoton were used to construct a calibration plot of relative fluorescent an Anchorchip target plate (Bruker Daltonics) and left to air units(RFU) versusoligonucleotide fragment concentration. dry. One microliter of oligonucleotide calibration standard (BrukerDaltonics)isthenpipettedontoamatrixspot,and Fluorogenicsubstratecleavage assay 1mLofsampleispipettedontosubsequentspotsandleftto air dry. A Hitachi F-700 fluorescence spectrometer (Hitachi High Tech- nologies) was fitted with a Hitachi Thermostatted cell holder ac- cessory.Thecellwasmaintainedat37°Cbywaterfeedfromawater bathat5.8L/min.Timescansuseda0.5datapitch,withPMTset 6Ribonuclease activity assays for VapC and VapC from M. to 450 V, excitation (ex.) 485 nm, emission (em.) 518 nm, 5 nm Rv0065 Rv0617 tuberculosiswereconductedin12mMphosphatebuffer(sodiumphosphate slits, and 2 msec response time. Scans for assays and blanks were typicallyusedexceptforMALDI-TOFMSwhereammoniumphosphatewas recordedfor100sec. used),6mMNaCl,and6mMMgCl2.Ribonucleaseactivityassaysfor A stock VapCPAE2754 was prepared at 0.2 mg/mL and a stock VapC andVapC fromP.aerophilumwereconductedin12 PAE0151 PAE2754 substrate solution prepared to 100 mM stock in nuclease free mMTris.HCl,6mMNaCl,and6mMMgCl.Individualassayreactions were set up for each time point to reduc2e the possibility of RNase water.Threehundredmicroliterassayreactionscontainingvarious contamination. concentrationsoffluorogenicsubstrate(0.25,0.5,0.75,1.0,1.5,2.0, 10 RNA,Vol. 18, No.6