ebook img

Community Structure of Ammonia-Oxidizing Archaea and Ammonia-Oxidizing Bacteria in Soil ... PDF

13 Pages·2015·1.71 MB·English
by  
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Community Structure of Ammonia-Oxidizing Archaea and Ammonia-Oxidizing Bacteria in Soil ...

Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 582938, 12 pages http://dx.doi.org/10.1155/2015/582938 Research Article Community Structure of Ammonia-Oxidizing Archaea and Ammonia-Oxidizing Bacteria in Soil Treated with the Insecticide Imidacloprid MariuszCycoN1andZofiaPiotrowska-Seget2 1DepartmentandInstituteofMicrobiologyandVirology,SchoolofPharmacywiththeDivisionofLaboratoryMedicine, MedicalUniversityofSilesia,Jagiellon´ska4,41-200Sosnowiec,Poland 2DepartmentofMicrobiology,UniversityofSilesia,Jagiellon´ska28,40-032Katowice,Poland CorrespondenceshouldbeaddressedtoMariuszCycon´;[email protected] Received18August2014;Revised1December2014;Accepted1December2014 AcademicEditor:QaisarMahmood Copyright©2015M.Cycon´andZ.Piotrowska-Seget. This is an open access article distributed under the Creative Commons AttributionLicense,whichpermitsunrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalworkis properlycited. The purpose of this experiment was to assess the effect of imidacloprid on the community structure of ammonia-oxidizing archaea(AOA)andammonia-oxidizingbacteria(AOB)insoilusingthedenaturinggradientgelelectrophoresis(DGGE)approach. AnalysisshowedthatAOAandAOBcommunitymemberswereaffectedbytheinsecticidetreatment.However,thecalculationof therichness(S)andtheShannon-Wienerindex(H)valuesforsoiltreatedwiththefieldrate(FR)dosageofimidacloprid(1mg/kg soil)showednochangesinmeasuredindicesfortheAOAandAOBcommunitymembers.Inturn,the10∗FRdosageofinsecticide (10mg/kgsoil)negativelyaffectedtheAOAcommunity,whichwasconfirmedbythedecreaseoftheSandHvaluesincomparison withthevaluesobtainedforthecontrolsoil.InthecaseofAOBcommunity,aninitialdeclinefollowedbytheincreaseoftheS andHvalueswasobtained.Imidaclopriddecreasedthenitrificationratewhiletheammonificationprocesswasstimulatedbythe additionofimidacloprid.ChangesinthecommunitystructureofAOAandAOBcouldbeduetoanincreaseintheconcentration + ofN-NH4 ,knownasthemostimportantfactorwhichdeterminesthecontributionofthesemicroorganismstosoilnitrification. 1.Introduction with the phospholipid fatty acid (PLFA), the denaturing gradient gel electrophoresis (DGGE), and the community- Imidacloprid [1-(6-chloro-3-pyridylmethyl)-N-nitro-imida- level physiological profile (CLPP) approaches showed that zolidin-2-ylideneamine] is a systemic insecticide used to imidacloprid induced significant changes in the composi- controltheinsectpestsandanimalparasites[1,2].Thisinsec- tion of microbial communities and their metabolic activity. ticide has a high affinity to the nicotinic acetylcholine Moreover, the DGGE profiles and results of imidacloprid receptorofinsectsandactsasaneurotoxin[3].Basedonthe degradationstudysuggestedtheevolutionofspecificbacteria resultsofmanystudies,theEuropeanFoodSafetystatedthat able to degrade this insecticide among autochthonous soil neonicotinoids pose an unacceptably high risk to bees and microorganisms[8].Withregardtotheimportanceofnitro- that the industry-sponsored science upon which regulatory genturnoverforsoilquality,presenceofimidaclopridinsoils agenciesclaimsofsafetyhavereliedmaybeflawed,oreven mayalsoaffectthenontargetmicroorganismsresponsiblefor deceptive[4]. theseprocesses.Beingoneofthem,nitrificationplaysacen- Imidaclopridischaracterisedbyahighpersistenceinsoil tralroleintheglobalnitrogencycleoftheenvironmentandit with half-life up to 229 days, and its behaviour depends on isverysensitivetovariouscontaminantsincludingpesticides. differentphysicochemicalandbiologicalparameterssuchas As the first and rate-limiting step of nitrification in soil, organicmatter,pH,temperature,crops,time,andmicrobial oxidation of ammonia to nitrite is catalysed by the ammo- activity[5–7].Inourpreviousstudy[8],theresultsobtained nia monooxygenase (AMO) [9, 10]. Previously, autotrophic 2 BioMedResearchInternational Table1:Characteristicsofthesoilusedintheexperiment. Parameter Value Methodofdetermination Reference Origin Pszczyna,Poland — — Sand(2000–50𝜇m)(%) 86.0±2.7 Sedimentationandsievingmethod ISO11277:2009 Silt(<50–2𝜇m)(%) 11.0±2.4 Sedimentationandsievingmethod ISO11277:2009 Clay(<2𝜇m)(%) 3.0±0.5 Sedimentationandsievingmethod ISO11277:2009 Densityg/cm3 1.2±0.2 Coremethod ISO11272:1998 pH (1:5) 6.6±0.3 Measurementwithglasselectrode ISO10390:2005 (inwater) Cationexchangecapacity(CEC)(cmol+/kg) 12.9±1.7 ModifiedGillmanmethod ISO11260:1994 Waterholdingcapacity(WHC)(%) 32.4±2.8 Gravimetricmethod ISO14239:1997 C (%) 1.0±0.2 OxidationinthepresenceofH SO ISO14235:1998 org 2 4 N (%) 0.09±0.03 ModifiedKjeldahlmethod ISO11261:1995 tot Microbialbiomass(mg/kgdryweight) 668.0±34.2 Substrate-inducedrespiration(SIR) ISO14240-1:1997 Thevaluesarethemeansofthreereplicateswiththestandarddeviation,whichwaswithin5%ofthemean. ammonia-oxidizing bacteria (AOB) of beta- and gamma- rate (FR) of imidacloprid and 10 times the FR (10 ∗ FR). proteobacteria were considered to be the most important Detailedinformationrelatedtotheexperimentaldesignand contributors to ammonia oxidation. However, the recent treatments is described in our previous study [8]. Samples developmentofmoleculartechniqueshasledtothediscovery of control and imidacloprid-treated soils were periodically ofamoAgenesthatencodethealpha-subunitofAMO,which removed (on days 1, 14, 28, and 56) for determination of raises questions about the role of AOB. Some studies have the genetic biodiversity of AOA and AOB, the number of recentlyshownthatammonia-oxidizingarchaea(AOA)that nitrifyingbacteria,andthenitrificationrate. are distributed in soil ecosystems potentially represent the most important group of ammonia oxidizers [11–13]. The 2.3.DeterminationofNitrateandAmmoniumConcentrations. populationsizesandcommunitystructureofAOBandAOA Theprocedureofextractionofsoilsamples(10g)with100mL areshiftinginresponsetotemperature,pH,fertilizerlevels, of 0.1% K2SO4 for 24h followed by the colorimetric assay altitude,andcontaminantsincludingpesticides[9,10,14,15]. ofnitrateandammoniumconcentrationsinthefiltrateswas Nevertheless,thereisnoinformationregardingtheinfluence used. The intensity of the yellow colour that resulted from of imidacloprid on ammonia oxidizers structure in soil. the reaction of nitrates with phenoldisulphonic acid (25% Therefore, the aim of this study was to assess the impact in conc. H2SO4) was measured, whereas ammonium was of this insecticide on the genetic biodiversity of AOA and determinedusingtheBerthelotreaction.Theconcentrations AOB using DGGE method. In addition, the nitrification ofbothionswereestimatedbyreferencetocalibrationcurves rate and the number of culturable nitrifying bacteria based andtheblankvaluesobtained,andtheresultswereexpressed on measurement of nitrate concentration and plate count asmgperkilogramofsoil[16]. methods,respectively,wereestimated. 2.4. Enumeration of Nitrifying Bacteria. Soil samples (10g) 2.MaterialsandMethods in 90mL of 0.85% sterile NaCl medium (pH 7.0) were shaken at 120rpm/min for 30min. The viable counts of 2.1.SoilSampling. Aloamysandsoilcollectedfromthetop nitrifyingbacteriawereenumeratedusingtheagarmedium ∘ layer (A-horizon) to a maximum depth of 20cm of grass- recommendedbyAaronson[17]afterincubationat22 Cfor covered field located at the area of Pszczyna, Upper Silesia, 10days.Resultswereexpressedasthelogcfu(colonyforming in southern Poland (49∘59󸀠48󸀠󸀠N, 18∘55󸀠14󸀠󸀠E) was used. unit)pergramofdrysoil. No plant protection products with imidacloprid or other pesticideshavebeenusedonthesamplingplace.Basedonthe 2.5. Analysis of AOA and AOB Community Structure by FAOSoilClassification,collectedsoilwasclassifiedasOrthic PCR-DGGE Method. To extract the total DNA from soil Luvisol.Forcollectedsoil,physicalandchemicalparameters samples, a GeneMATRIX Soil DNA Purification Kit (Eur , x wereassessed,andtheirvaluesandmethodsofdetermination Poland) was used according to the manufacturer’s instruc- areshowninTable1. tion. Next, the DNA was subjected to electrophoresis in a 1.0% (w/v) agarose gel followed by its quantification using 2.2. Soil Treatment. Certified standard of imidacloprid thespectrophotometermethod(Biophotometer,Eppendorf). (99.8%chemicalpurity)waspurchasedfromSigma-Aldrich Archaeal amoA genes were amplified using primers Arch- (Germany) and used for the contamination of soil. The amoAF and arch-amoAR, while bacterial amoA genes were performed experiment had a completely randomized block amplified by amoA-1F and amoA-2R (Table2). For PCR design that included three replications and the following reactions, a mixture that contained 1 × GoTaq Flexi Buffer treatments: control and two insecticide dosages (1 and (Promega), 2mM MgCl2, 0.2mM dNTP Mix (Promega), 10mg/kgsoil)whichcorrespondedtotherecommendedfield 0.5𝜇Mofeachprimer(Sigma-Aldrich),0.2𝜇gofDNA,and BioMedResearchInternational 3 Table2:Primersusedformolecularanalysesinthisstudy. 󸀠 󸀠 Targets Primers Sequence(5-3) Lengthofamplicon(bp) References Arch-amoAF STAATGGTCTGGCTTAGACG AOA 635 [34] arch-amoAR GCGGCCATCCATCTGTATGT amoA-1F GGGGTTTCTACTGGTGGT AOB 491 [35] amoA-2R CCCCTCKGSAAAGCCTTCTTC AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria.Forty-basepairGC-clamp,CGCCCGCCGCGCGCGGCGGGCGGGGCGGGG 󸀠 GCACGGGGGC[36],wasattachedtothe5 endoftheforwardprimers. 1.5U/𝜇LGoTaqDNAPolymerase(Promega)wasused.The analyseswereperformedusingtheStatistica10.0PLsoftware amplification procedure was performed using a PTC-118 package. Thermal Cycler (Bio-Rad, CA, USA) under the following ∘ conditions:(i)aninitialdenaturationstepof95 Cfor3min, 3.Results (ii) 35 cycles of denaturation, annealing, and extension ∘ ∘ ∘ − + (95 C for 1min followed by 53 C, AOA, or 55 C, AOB, for 3.1.ConcentrationofN-NO andN-NH . Theobtaineddata 3 4 ∘ 1min, with an extension step at 72 C for 1min), and (iii) revealedthattheapplicationoftheinsecticideimidacloprid ∘ a final extension at 72 C for 7min. After amplification, the had a significant effect on nitrogen transformation in soil. products in the mixture were purified using a QIAquick Imidaclopridatbothdosagescausedasignificant(𝑃 < 0.05) − PCR Purification Kit (Qiagen, USA) as described in the decrease (by 25–65%) in N-NO3 concentrations and this manufacturer’sinstruction. effectwasobservedthroughoutthewholeincubationperiod The PCR products were analyzed in an 8% (w/v) poly- (Figure1(a)).Incontrast,bothimidaclopriddosagescauseda acrylamidegel(37.5:1acrylamide:bisacrylamide)composed significant(𝑃 < 0.05)increaseoftheN-NH4+concentration ofalineardenaturinggradientrangingfrom30%to55%and in soils over the experimental period. For example, the from40%to60%forAOAandAOB,respectively.Denaturant concentration of N-NH4+ in the 10 ∗ FR-treated soil was solutionswerepreparedbymixingtheappropriatevolumes several times higher than in the controlsoil on days 14, 28, of two (0–100%) denaturant stock solutions (7mol/L urea and 56 (Figure1(b)). The statistical analysis indicated that and40%v/vformamide).Electrophoresiswasperformedin concentrationsofbothionsweresignificantlyaffectedbythe a 1 × TAE buffer with a constant voltage of 80V for 17h at treatment(𝑃 < 0.001)andtheincubationtime(𝑃 < 0.001). ∘ 60 C using a DCode Mutation Detection System (Bio-Rad, In addition, the interaction between these factors was also USA).Theobtainedgelswerestainedwithethidiumbromide significant (𝑃 < 0.001). For both ions, the treatment effect − (0.5mg/mL) followed by their analysis with Quantity One explainedmostofthevariance(83%forN-NO3 and64%for + software (Bio-Rad, USA) to compare the AOA and AOB N-NH4 )(Table3).ValuesofPearson’scorrelationcoefficient community structures between control and imidacloprid- (𝑟) also indicated that the concentration of N-NO3− was treated soils. Phylogenic dendrograms that were based on negatively correlated with N-NH4+ (−0.776, 𝑃 < 0.001) the presence/absence of a band and band weighting (band and 𝐸𝐻-AOA (−0.478, 𝑃 = 0.003) while being positively density) analyses were constructed by applying the Dice correlatedwiththenumberofculturablenitrifyingbacteria coefficient and the unweighted pair-group method using (0.866,𝑃<0.001),𝐻-AOA(0.663,𝑃<0.001),𝑆-AOA(0.727, thearithmeticaverages(UPGMA).Richness(𝑆)valueswere 𝑃 < 0.001), 𝐻-AOB (0.417, 𝑃 = 0.011), and 𝑆-AOB (0.377, calculated as the number of DNA bands detected in the 𝑃 < 0.023). In contrast, N-NH4+ was negatively correlated respective line of the DGGE profile, while the Shannon- with the number of culturable nitrifying bacteria, 𝐻-AOA, Wienerindex(𝐻)andevenness(𝐸𝐻)valueswerecalculated and𝑆-AOA(Table4). according to the equations 𝐻 = −∑𝑝𝑖(ln𝑝𝑖) and 𝐸𝐻 = 𝐻/𝐻max = 𝐻/ln𝑆, respectively, where 𝑝𝑖 is the ratio 3.2.NumberofCulturableNitrifyingBacteria. Theplatecount between the specific band intensity and the total intensity resultsshowedthattheapplicationofimidaclopridnegatively of all bands and 𝑆 is the total number of bands in each affectedthenumberofculturablenitrifyingbacteria.Inthe sample. case of lower dosage of imidacloprid, this effect lasted up to 28 days. In contrast, in soil treated with imidacloprid at 2.6.StatisticalAnalyses. Todeterminethepercentageofthe the 10 ∗ FR dosage a negative effect was observed during variation attributable to the tested factors, that is, treat- thewholeexperimentalperiod,andthenumberofculturable ment and incubation time, a two-way analysis of variance nitrifying bacteria was significantly (𝑃 < 0.05) lower (ANOVA)fortheobtainedresultswasapplied.Thestatistical (one or two orders of magnitude) than that in the control significanceofdifferencesinthedatathatwasmeasuredwas samples(Figure2).TheANOVAshowedthatthenumberof assessed by a post hoc comparison of the means using the culturablenitrifyingbacteriawassignificantlyaffectedbythe least significant differences (LSD) test. The obtained results treatment(𝑃 < 0.001)andtheincubationtime(𝑃 < 0.001). werealsosubjectedtoprincipalcomponentanalysis(PCA). In addition, the interaction between these factors was also To determine the correlations between measured parame- significant(𝑃 = 0.004).Thetreatmenteffectexplainedmost ters,Pearson’scorrelationcoefficientwasalsocalculated.All of the variance (74%) whereas the incubation time and the 4 BioMedResearchInternational 45 26 k 24 40 a a 22 h 35 20 e −O/kg soil)3 2350 b d f g dg +H/kg soil)4 111468 f j N 20 N 12 g mg N– 15 c ce c e mg N– 10 b c e i ( ( 8 a a d 10 6 4 5 2 0 0 1 14 28 56 1 14 28 56 Day after application Day after application C C FR FR 10∗FR 10∗FR − + (a) N-NO3 (b) N-NH4 − + Figure1:Theconcentration(mg/kgsoil)ofN-NO3 (a)andN-NH4 (b)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil; 10∗FR:10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Thedifferentlettersindicatesignificant differences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime. 6.0 interactionbetweenbothfactorsaccountedforonly10%and 8%ofthevariance,respectively(Table3).ValuesofPearson’s 5.5 d correlationcoefficient(𝑟)alsoindicatedthatthenumberof 5.0 a culturable nitrifying bacteria was positively correlated with 4.5 ag bg 𝐻-AOA(0.717,𝑃<0.001),𝑆-AOA(0.731,𝑃<0.001),𝐻-AOB bf b g (0.452,𝑃=0.006),and𝑆-AOB(0.436,𝑃=0.008)(Table4). 4.0 f oil) eh y s 3.5 h 3.3.CommunityStructureof dr g 3.0 c ce Ammonia-OxidizingMicroorganisms u/ g cf 2.5 3.3.1. Ammonia-Oxidizing Archaea (AOA). The obtained o (l 2.0 DGGE patterns showed that both dosages of imidacloprid caused changes in the structure of the AOA community 1.5 duringtheexperimentalperiod(Figure3(a)).Thedosageof 1.0 insecticidewasthemainfactorthatgroupedthetreatments, regardlessofthetimeelapsedasindicatedbytheperformed 0.5 cluster analysis (Figure3(b)). Despite the differences in the 0.0 DGGE profiles between the imidacloprid-treated and con- 1 14 28 56 trol soil, the calculation of the Shannon-Wiener index (𝐻) Day after application (Figure4(a)) and the richness (𝑆) (Figure4(b)) values for C soil treated with the field rate (FR) dosage of imidacloprid FR (1mg/kg soil) showed no changes in measured indices for 10∗FR theAOAcommunitymembers.Inturn,the10∗FRdosage Figure2:Thenumberofnitrifyingbacteria(logcfu/gdrysoil)in of insecticide (10mg/kg soil) negatively affected the AOA soil treated with imidacloprid (C: control; FR: 1mg/kg soil; 10 ∗ community,whichwasconfirmedbythedecreaseofthe𝐻 FR:10mg/kgsoil).Thedatapresentedarethemeansandstandard and𝑆valuesincomparisonwiththevaluesobtainedforthe deviations of three replicates. Different letters indicate significant controlsoil(Figures4(a)and4(b)). differences (𝑃 < 0.05, LSD test), considering the effects of the TheANOVAanalysisrevealedthatthe𝐻indexforAOA pesticidedosageandtime. wassignificantlyaffectedbythetreatment(𝑃 < 0.001)and BioMedResearchInternational 5 Table3:Thetwo-wayANOVAanalysisforthemeasuredparameters. Parameter Sourceofvariation df Sumofsquares Meansquares Varianceexplained(%) 𝐹 𝑃 Concentrationofions Treatment 2 1908.79 954.40 83 989.3 P<0.001 N-NO − Time 3 158.20 52.73 7 54.6 P<0.001 3 Treatment×time 6 204.12 34.02 9 35.3 P<0.001 Treatment 2 819.2 409.6 64 2275.5 P<0.001 N-NH + Time 3 282.2 94.1 22 522.6 P<0.001 4 Treatment×time 6 13.9 28.9 13 161.1 P<0.001 Treatment 2 15.65 7.83 74 124.7 P<0.001 Numberofnitrifyingbacteria Time 3 2.23 0.74 10 11.8 P<0.001 Treatment×time 6 1.63 0.27 8 4.3 P=0.004 AOA-DGGEanalysis Treatment 2 0.21 0.11 64 61.2 P<0.001 𝐻 Time 3 0.02 0.01 8 4.8 P=0.009 Treatment×time 6 0.05 0.001 16 5.1 P=0.002 Treatment 2 24.50 12.25 72 73.5 P<0.001 𝑆 Time 3 0.66 0.22 2 1.3 𝑃=0.286 Treatment×time 6 4.83 0.81 14 4.8 P=0.002 Treatment 2 0.002 0.0009 24 7.1 P=0.004 𝐸𝐻 Time 3 0.001 0.0004 15 3.0 𝑃=0.052 Treatment×time 6 0.002 0.0003 20 2.0 𝑃=0.112 AOB-DGGEanalysis Treatment 2 0.52 0.26 34 214.6 P<0.001 𝐻 Time 3 0.46 0.15 30 126.3 P<0.001 Treatment×time 6 0.53 0.09 35 72.9 P<0.001 Treatment 2 7.72 3.86 28 139.0 P<0.001 𝑆 Time 3 9.42 3.14 34 113.0 P<0.001 Treatment×time 6 9.83 1.63 36 59.0 P<0.001 Treatment 2 0.0012 0.0005 10 2.5 𝑃=0.102 𝐸𝐻 Time 3 0.0009 0.0003 8 1.4 𝑃=0.267 Treatment×time 6 0.0039 0.0007 36 3.1 P=0.023 AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria;𝐻:Shannon-Wienerindex;𝑆:richness;𝐸𝐻:evenness.Theeffectsinboldaresignificant at𝑃<0.05. theincubationtime(𝑃 = 0.009).Inaddition,theinteraction DGGEfingerprintsamongbothtreatmentsandcontrolsoil between these factorswas alsosignificant (𝑃 = 0.002). The (Figure5(a)).Thedosageofinsecticidewasthemainfactor treatmenteffectexplained64%ofthevariance,whereastime that grouped the treatments, regardless of the time elapsed accounted for only 8% of the variance. The interactions asindicatedbytheperformedclusteranalysis(Figure5(b)). betweenthesefactorsexplainedafurther16%(Table3).The Cluster analysis generally showed that imidacloprid dosage richness value (𝑆) for AOA was also significantly affected was the main factor grouping the treatments, regardless by the treatment (𝑃 < 0.001) as well as by the interaction of the time elapsed (Figure5(b)). Despite the differences betweentreatmentandtime(𝑃=0.002).Thetreatmenteffect in the DGGE profiles between the imidacloprid-treated explained most of the variance (72%) and the interactions and control soil, the calculation of the Shannon-Wiener between these factors explained a further 14% (Table3). index (𝐻) (Figure6(a)) and the richness (𝑆) (Figure6(b)) The two-way ANOVA also indicated that the incubation values for soil treated with the field rate (FR) dosage of timeandtheinteractionsbetweentreatmentandtimewere imidacloprid(1mg/kgsoil)showednochangesinmeasured factors which did not significantly affect the 𝐸𝐻 value for indicesfortheAOBcommunitymembersondays1,14,and AOA during the experiment. However, the treatment effect 28. In contrast, the values of both indices (𝐻 and 𝑆) were significantly (𝑃 = 0.004) affected the measured parameter, significantly (𝑃 < 0.005) higher on day 56 in comparison anditexplainedmostofthevariance(24%)(Table3). with the values obtained for the control soil. In the case of the10∗FRdosageofinsecticide,aninitialdecline(ondays 3.3.2. Ammonia-Oxidizing Bacteria (AOB). The PCR- 1and14)followedbytheincrease(onday56)ofthe𝑆and𝐻 DGGEprofilesofsoilAOBcommunityunderimidacloprid values was obtained for AOB community(Figures6(a) and stress also showed that there were significant changes in 6(b)). 6 BioMedResearchInternational Table4:ValuesofPearson’scorrelationcoefficient(𝑟)forcorrelationamongmeasuredmicrobialparameters. N-NO3− N-NH4+ Number 𝐻-AOA 𝑆-AOA 𝐸𝐻-AOA 𝐻-AOB 𝑆-AOB 𝐸𝐻-AOB PC1 PC2 − N-NO 1 3 −0.776 + N-NH4 P<0.001 1 0.866 −0.633 Number P<0.001 P<0.001 1 0.663 −0.414 0.717 𝐻-AOA P<0.001 P=0.012 P<0.001 1 0.727 −0.488 0.731 0.952 𝑆-AOA P<0.001 P=0.003 P<0.001 P<0.001 1 𝐸𝐻-AOA P−=0.04.70803 P0=.305.0733 P−=0.03.50832 𝑃−=0.204.1452 P−=0.04.90802 1 𝐻-AOB P0=.401.7011 𝑃0=.001.6925 P0=.405.0206 P0<.600.0101 P0<.601.0801 𝑃−=0.03.20454 1 𝑆-AOB P0=.307.0723 𝑃0=.008.6907 P0=.403.0608 P0<.507.0101 P0<.508.0701 𝑃−=0.03.00868 P0<.908.0301 1 𝐸𝐻-AOB 𝑃0=.006.7314 𝑃−=00.1.73120 𝑃0=.003.0861 𝑃0=.008.7614 𝑃=0.101.5505 𝑃−=0.01.34434 𝑃0=.300.0570 𝑃0=.104.7391 1 0.867 −0.577 0.859 0.870 0.929 −0.549 0.727 0.688 0.200 PC1 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 𝑃=0.241 1 −0.379 0.732 −0.266 0.052 0.003 0.104 0.659 0.684 0.193 0.000 PC2 P=0.023 P<0.001 𝑃=0.117 𝑃=0.764 𝑃=0.987 𝑃=0.546 P<0.001 P<0.001 𝑃=0.259 𝑃=1.000 1 AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria;𝐻:Shannon-Wienerindex;𝑆:richness;𝐸𝐻:evenness.Theeffectsinboldaresignificant at𝑃<0.05. Thestatisticalanalysisrevealedthatthe𝐻indexforAOB (Figure7). Analysisofcorrelationamongtested parameters wassignificantly(𝑃 < 0.001)affectedbythetreatmentand showedthatPC1valuescorrelatedmainlywiththenumberof the incubation time. In addition, the interaction between culturablenitrifyingbacteriaaswellaswiththebiodiversity thesefactorswasalsosignificant.Bothfactorsandinteraction ofAOAandAOBcommunitymembers,whereasPC2values between them explained more or less equal (30%–35%) correlatedmainlywiththebiodiversityofAOB. variance (Table3). The richness value (𝑆) for AOB was also ImidaclopridnegativelyaffectedtheconcentrationofN- significantly (𝑃 < 0.001) affected by the treatment and the NO3− in soil, whereas the concentration of N-NH4+ has timeaswellasbytheinteractionbetweenbothfactors.The increasedduringtheexperimentalperiod.Manyauthorscon- interaction between considered factors explained most of firmedthatnitrificationprocessismoresensitivetopesticides the variance (36%). The treatment and the time explained than ammonification. For example, Martinez-Toledo et al. further24%and34%ofthevariance,respectively(Table3). [18],studyingtheeffectofmethylpyrimifosonsoilmicroflora, The ANOVA also indicated that the interaction between revealedthatthisinsecticidesignificantlydecreasedthenitri- treatmentandtimewastheonlyfactorsignificantlyaffecting ficationrateinagriculturalsoil.Similarly,otherinsecticides the𝐸𝐻valueduringtheexperiment(Table3). (e.g.,diazinon,teflubenzuron,lambda-cyhalothrin,phorate, carbofuran, and fenvalerate) were found to be the factors − 4.Discussion responsible for the significant decrease of N-NO3 in soil [19–22]. This phenomenon observed for the imidacloprid- The impact of imidacloprid on the structure of ammonia- treatedsoilcanbeexplainedbythefactthatarchaeaand/or oxidizing microorganisms was assessed via PCR-DGGE. bacteria involved in ammonia oxidizing might be killed + Complex fingerprints for both microbial groups (AOA and by the insecticide and the transformation of N-NH4 into − AOB) were obtained and multivariate statistical analysis N-NO3 was stopped in the soil. This fact may also be was used to assess the effects of insecticide and sampling confirmedbytheplatecountdatawhichshowedthedecrease time on their community structure. The two-way ANOVA of the number of culturable nitrifying bacteria during the indicatedthatmeasuredparametersweresignificantly(𝑃 < experimental period. It is also a high probability that the 0.05) affected by the treatment and the incubation time, degradationprocessofimidaclopridcouldalsohaveresulted + andmoreovertheinteractionbetweenthesefactorswasalso intheproductionofN-NH4 .Moreover,theresultsofsome significant.Ingeneral,thetreatmenteffectexplainedmostof studieshaveshownthatpesticidesstimulateammonification thevariance(Table3).Moreover,thePCAclearlyseparated by killing a remaining sensitive part of soil microorgan- measured parameters especially in 10 ∗ FR-treated and isms that are subjected to mineralisation processes, con- controlsoilsamples.TheprincipalcomponentsPC1andPC2 sequently increasing the ammonium concentration in soils accounted for 61.1% and 16% of this variation, respectively [23]. BioMedResearchInternational 7 10∗FR-3 (day 28) 10∗FR-2 (day 28) 10∗FR-3 (day 1) Day 1 10∗FR-2 (day 1) C FR 10∗FR 10∗FR-1 (day 1) 1 2 3 1 2 3 1 2 3 10∗FR-3 (day 14) 10∗FR-2 (day 14) 10∗FR-1 (day 14) 10∗FR-1 (day 28) FR-3 (day 56) FR-3 (day 28) FR-2 (day 28) Day 14 10∗FR-1 (day 56) C FR 10∗FR 10∗FR-3 (day 56) 1 2 3 1 2 3 1 2 3 10∗FR-2 (day 56) C-3 (day 14) C-2 (day 14) C-1 (day 14) FR-3 (day 1) FR-2 (day 1) FR-1 (day 1) Day 28 C-2 (day 1) C FR 10∗FR FR-3 (day 14) 1 2 3 1 2 3 1 2 3 FR-2 (day 14) FR-1 (day 14) C-3 (day 1) C-1 (day 1) FR-2 (day 56) FR-1 (day 28) C-3 (day 28) Day 56 C-1 (day 28) C FR 10∗FR FR-1 (day 56) 1 2 3 1 2 3 1 2 3 C-3 (day 56) C-2 (day 56) C-1 (day 56) C-2 (day 28) 0.30 0.25 0.20 0.15 0.10 0.05 0.00 (a) DGGEprofiles (b) Phylogenicdendrogram Figure3:DGGEprofiles(a)andphylogenicdendrogram(b)forPCR-amplifiedarchaealamoAgeneforsoiltreatedwithimidacloprid(C: control;FR:1mg/kgsoil;10∗FR:10mg/kgsoil). The DGGE analysis showed that AOA were more sen- overallrichness(𝑆)andthediversity(𝐻)ofAOAand/orAOB sitive to imidacloprid than AOB. Moreover, there were community members. Several studies have demonstrated differences between profiles obtained for the imidacloprid- that the excessive use of pesticides has raised concerns treated and control soils manifested by the disappearance regardingthetoxiceffectsonnontargetingmicroorganisms. of some bands (for AOA) or the appearance of several new Increasingevidencehasindicatedthatpesticideschangethe bands(forAOB),especiallyinsoilsamplestreatedwiththe communitystructureofAOAand/orAOBanddecreasethe 10 ∗ FR dosage. The richness (𝑆) and genetic diversity (𝐻) nitrificationrateinsoil.Forexample,usingDGGE,Lietal. valuesforAOAweresignificantlylowerincomparisonwith [24] demonstrated that acetochlor had a negative effect on thevaluesobtainedforthecontrolsoil,whereasforAOBthe AOBdiversityinsoil.PampulhaandOliveira[25]indicated diversityindiceschangedfromdecreasingattheinitialstage that the presence of bromoxynil and prosulfuron strongly toincreasingattheendoftheexperimentalperiod,suggest- inhibited the growth of AOB in sandy soil. Gigliotti and ing that imidacloprid may stimulate the increase of AOB. Allievi[26]describedthatcinosulfuronandbensulfuron,at The observed phenomenon suggests that sensitive species thenormalfieldapplicationrateandata100-foldhigherrate, among ammonia-oxidizing microorganisms were replaced decreasedthenitrificationactivityinagriculturalsoil. by microorganisms characterised by a higher tolerance to Our results also suggest that observed changes in the this insecticide and/or the ability to degrade imidacloprid. community structure of AOA and AOB could be due to + The result of these changes might be the increase of the an increase in the concentration of N-NH4 . In some pre- numbersofspecificmicroorganismsandthedecreaseinthe vious studies on agricultural soils, long-term N fertilizer 8 BioMedResearchInternational 2.50 12 11 2.25 b d ab a ab a a a a b a 10 a a a a e e e c 2.00 9 d c d d 8 1.75 b 7 1.50 6 1 14 28 56 1 14 28 56 Day after application Day after application C C FR FR 10∗FR 10∗FR (a) Shannon-Wienerindex(𝐻) (b) Richness(𝑆) 1.00 bce e 0.98 c bce acac be c acd 0.96 a d a 0.94 0.92 0.90 1 14 28 56 Day after application C FR 10∗FR (c) Evenness(𝐸𝐻) Figure4:Thediversityindicesforammonia-oxidizingarchaea(AOA)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil;10∗FR: 10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Differentletters(withineachindex)indicate significantdifferences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime. BioMedResearchInternational 9 FR-2 (day 28) FR-3 (day 1) C-3 (day 1) C-1 (day 1) C-2 (day 28) Day 1 FR-2 (day 14) C FR 10∗FR FR-1 (day 14) 1 2 3 1 2 3 1 2 3 FR-1 (day 1) C-2 (day 1) C-3 (day 56) C-2 (day 56) C-1 (day 56) FR-3 (day 28) FR-1 (day 28) Day 14 C FR 10∗FR C-3 (day 28) 1 2 3 1 2 3 1 2 3 C-1 (day 28) FR-3 (day 14) C-2 (day 14) FR-2 (day 1) C-3 (day 14) C-1 (day 14) 10∗FR-3 (day 1) Day 28 10∗FR-2 (day 1) C FR 10∗FR 10∗FR-1 (day 1) 1 2 3 1 2 3 1 2 3 10∗FR-3 (day 14) 10∗FR-2 (day 14) 10∗FR-1 (day 14) FR-3 (day 56) 10∗FR-1 (day 28) 10∗FR-3 (day 28) 10∗FR-2 (day 28) Day 56 C FR 10∗FR 10∗FR-3 (day 56) 10∗FR-2 (day 56) 1 2 3 1 2 3 1 2 3 10∗FR-1 (day 56) FR-2 (day 56) FR-1 (day 56) 0.6 0.5 0.4 0.3 0.2 0.1 0.0 (a) DGGEprofiles (b) Phylogenicdendrogram Figure5:DGGEprofiles(a)andphylogenicdendrogram(b)forPCR-amplifiedbacterialamoAgeneforsoiltreatedwithimidacloprid(C: control;FR:1mg/kgsoil;10∗FR:10mg/kgsoil). + applicationseemedtostimulatethegrowthofAOB[13,27]. have a preference for low N-NH4 concentration in soil This could be explained by a stimulatory effect of high N- [32].AlthoughthediversityandrichnessofAOBcommunity NH4+ concentrationontheAOBdiversityandrichness.On memberswerehigherafterapplicationof10∗FRdosageof the contrary, the diversity and richness indices for AOA imidacloprid,nitrificationratewaslowerincomparisonwith + − (Figure4) showed a declining trend by increasing N-NH4 thecontrolsoilasindicatedbythedecreaseofN-NO3 .These concentrationduringtheexperimentalperiod(Figure1(b)). results and the simultaneous decrease in the diversity and Similar results have been reported by Di et al. [28], who richnessofAOAcommunitymembersmayfurthersupport observedthatAOBandAOAhaddifferentgrowthpatterns hypothesis that AOA rather than AOB control nitrification under contrasting soil N conditions. In addition, analysis [15].However,someauthorsshowedthatsoilnitrificationwas of values of Pearson’s correlation coefficient (𝑟) revealed significantlycorrelatedwiththeabundanceofbacterialamoA significant correlations (𝑃 < 0.05) between the values of genes[30,31].SuchdifferencesincontributionsofAOBand diversity and richness indices for AOA and AOB and N- AOAmaybeduetodifferentfactors,amongwhichthemost + + NH4 concentration (Table4). These results indicated that importantisprobablytheconcentrationofN-NH4 [15,33]. + N-NH4 concentration may be the most important factor determining the contribution of these microorganisms to 5.Conclusions soilnitrification.Moreover,asfoundindifferentecosystems, the AOA amoA copy numbers were more abundant than Basedontheobtainedresults,weconcludedthattheappli- AOB [29–31]. Therefore, our results also provide further cation of imidacloprid changed the structure of ammonia- evidences to support the hypothesis that AOB growth is oxidizingmicroorganisms.Insecticidesignificantlyincreased + favoured by high concentration of N-NH4 , whereas AOA the diversity and richness of AOB but suppressed the 10 BioMedResearchInternational 1.90 7 e e c 1.70 c ad 6 ac ad cd d d a a 1.50 a a a a a a a a 5 1.30 4 1.10 b b b b 3 0.90 0.70 2 1 14 28 56 1 14 28 56 Day after application Day after application C C FR FR 10∗FR 10∗FR (a) Shannon-Wienerindex(𝐻) (b) Richness(𝑆) 1.00 b c ac 0.98 bd ac c ace cde a e 0.96 a a 0.94 0.92 0.90 1 14 28 56 Day after application C FR 10∗FR (c) Evenness(𝐸𝐻) Figure6:Thediversityindicesforammonia-oxidizingbacteria(AOB)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil;10∗FR: 10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Differentletters(withineachindex)indicate significantdifferences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime.

Description:
1Department and Institute of Microbiology and Virology, School of Pharmacy with Received 18 August 2014; Revised 1 December 2014; Accepted 1 December 2014 .. (e.g., diazinon, teflubenzuron, lambda-cyhalothrin, phorate,.
See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.