.!^^'.'r.'r..!f^?T-.pF STAND & TECH NIST III ""^UCATIONS AlNllDbi^5s4557r National Institute of Standards and Technology Technology Administration, U.S. Department of Commerce NIST Special Publication SP-1059 Bibliography of NIST Biosystems and Health Publications 2001-2005 .vicgcgcttgcgacagttaiiu. ,uagcttctcgcgcttgcgacagttatccgaa^ atccgaagctctcgagtgcggtcgatacg gaag ^tttccgaagct ctcgagtgcg ggtcgatacg g vcgaagctctcgagtgcg ggtcgatacg^ oo Nancy AUmang / ULSl September 27, 2006 . NIST Special Publication 1059 NIST Bibliography of Biosystems and Health Publications 2001-2005 Nancy A. AUmang Informtion Set-vicesDivision TechniologyServices September 2006 U.S. Department ofCommerce CarlosM. Gutierrez, Secretary Technology Administration Robert Cresanti, UnderSecretaryofCommercefor Technology National Institute ofStandards andTechnology WilliamJeffrey, Director Certain commercial entities, equipment, ormaterials maybe identified in this document in orderto describe an experimental procedure orconcept adequately. Such identification is not intended to imply recommendation orendorsement by the National Institute ofStandards and Technology, nor is it intended to imply that the entities, materials, orequipmentare necessarily the best available for thepurpose. National Institute ofStandards and Technology Special Publication 1059 Natl. Inst. Stand. Technol. Spec. Publ. 1059, 83 pages (September 2006) CODEN: NSPUE2 INTRODUCTION This document contains a listing ofover 1000journal articles and conference papers written by National Institute ofStandards and Technology (NIST) scientists working in the area of measurements and standards for Biosystems and Health. This includes: biochemistry, biophysics, molecular biology, nuclear radiology, biomaterials, biomedical engineering, cell biology, biotechnology, and several others. The list was compiled using the MEDLINE, Web ofScience, and IEEE Xplore databases as well as CSA Materials Research Database with METADEX. The Information Services Division (ISD) worked with the Biosystems and Health Strategic Working Group (SWG) to develop a comprehensive list ofsearch terms in order to develop this SWG list. The is comprised ofrepresentatives from across NIST's varied and multidisciplinary research staff. Search terms were entered into the four databases, and search results from each database were then combined into one central document by means ofcitation management software. While this database is comprehensive, it is far from complete. The following qualifications apply: • The timeframe is limited to research published in 2001-2005. Ongoing research projects may still have significant accomplishments that will not be reported until 2006 or beyond. • The selected search terms do not cover the entirety ofbio-related research efforts being conducted at NIST. As a result, there are several publications not included in this list. For further technical information, please contact one ofthe following members ofthe Biosystems and Health Strategic Working Group: Mr. Steven Emmerich Dr. Nien-Fan Zhang NIST NIST Building andFireResearch Laboratory Information TechnologyLaboratory 100 Bureau Drive, Stop 8633 100 Bureau Drive, Stop 8980 MD MD Gaithersburg, 20899-8633 Gaithersburg, 20899-8980 Phone: Phone: (301) 975-2842 E-mail: [email protected] E-mail: [email protected] Dr. Laurie E. Locascio Dr. Ram D. Sriram NIST NIST ChemicalScience and TechnologyLaboratory ManufacturingEngineeringLaboratory 100 Bureau Drive, Stop 8310 100 Bureau Drive, Stop 8263 MD MD Gaithersburg, 20899-8310 Gaithersburg, 20899-8263 Phone: (301) 975-3130 (301) 975-3507 E-mail: [email protected] E-mail: [email protected] I Dr. Stephen A. Wise Ms. Carroll Thomas NIST NIST Chemical Science and TechnologyLaboratory ManufacturingExtension Partnership 100 Bureau Drive, Stop 8390 Program MD Gaithersburg, 20899-8390 100 Bureau Drive, Stop 4800 MD Phone: (301) 975-3112 Gaithersburg, 20899-4800 E-mail: Stephen.wise(S)nist.gov Phone: (301) 975-5031 E-mail: caiToll.thomas(fl),nist.gov Dr. Michael Gaitan Dr. William Ott NIST NIST Electronics andElectricalEngineering Physics Laboratory Laboratory 100 Bureau Drive, Stop 8400 MD 100 Bureau Drive, Stop 8120 Gaithersburg, 20899-8400 MD Gaithersburg, 20899-8120 Phone: (301)975-4202 Phone: (301) 975-2070 E-mail: [email protected] E-mail: [email protected] Dr. Kent Rochford Dr. Eric J. Amis NIST NIST Electronics andElectricalEngineering Materials Science andEngineering Laboratory Laboratory Optoelectronics Division, 815 100 Bureau Drive, Stop 8500 MD 325 Broadway, Mailcode 815.00 Gaithersburg, 20899-8500 Boulder, BO 80305-3328 Phone: (301) 975-6681 Phone: (303)497-5285 E-mail: eric.amis(a)nist.gov E-mail: kent.rochford(a)boulder.nist.gov For further information regarding NIST's information resources and the creation ofthis bibliography, please contact: Nancy Allmang, MLS Reference Librarian SWG Liaison, Biosystems and Health Information Services Division, 250 Phone:(301) 975-4189 E-mail: [email protected] 2 Bibliography of NIST Biosystems and IHeaith Publications, 2001-2005 Abdulaev NG. 2003. "Building a stage for interhelical play in rhodopsin." Trends in Biochemical Sciences 28 (8): 399-402. Abylkassimova Z, Land C, Hartshome M, Crooks L, LuckyanovN, Bouville A, Simon S, Weinstock B, Romanyukha A, Fillmore CM, Gusev B, Zhumadilov Z, Chaizhunusova N. 2001. "Fallout exposure in Kazakhstan and thyroid disease prevalence." Epidemiology 12 (4): S83. Akbasak BS, Budowle B, Reeder DJ, Redman J, Kline MC. 2001. "Turkish population data with the CODIS multiplex short tandem repeat loci." Forensic Science International 123 (2-3): 227- 229. Akerman B, Cole KD. 2002. "Electrophoretic capture ofcircular DNA in gels." Electrophoresis 23 (16): 2549-2561. Akers DL, Goldberg RN. 2001. "BioEqCalc: A package for performing equilibrium calculations on biochemical reactions." The MathematicaJournal 8: 86-1 13. Alfassi ZB, Huie RE, Milman BL, Neta P. 2003. "Electrospray ionization mass spectrometry of ionic liquids and determination oftheir solubility in water." AnalyticalandBioanalytical Chemistry 377 (1): 159-164. Ambjomsson T, Apell S., Konkoli ., DiMarzio E, Kasianowicz JJ. 2002. "Charged polymer membrane translocation." The Journal ofChemicalPhysics 1 17: 4063-4073. Ames JB, Hamasaki N, Molchanova T. 2002. "Structure and calcium-binding studies ofa recoverin mutant (E85Q) in an allosteric intermediate state." Biochemistry 41 (18): 5776-5787. Ames JB, Ikura M. 2002. "Structure and membrane-targeting mechanism ofretinal Ca2+-binding proteins, recoverin and GCAP-2." Advances in ExperimentalMedicine andBiology 514: 333- 348. Ames JB, Vyas V, Lusin JD, Mariuzza R. 2005. "NMR structure ofthe natural killer cell receptor 2B4 (CD244): impHcations for Hgand recognition." Biochemistry 44 (17): 6416-6423. Amos MD, Bridges AJ. 2005. "Standards for autoantibody testing; Addressing future needs for autoimmune disease and cancer diagnosis." CancerBiomarkers 1: 224-227. Andersen O, Schwarz FP, Eisenstein E, Jacobsen C, Moestrup SK, Etzerodt M, Thogersen HC. 2001. "Dominant thermodynamic role ofthe third independent receptorbinding site in the receptor-associated protein RAP" Biochemistry 40: 15408-15417. Anderson NA, Lian T. 2005. "Ultrafast electron transfer at the molecule-semiconductor nanoparticle interface." AnnualReview ofPhysical Chemistry 56: 491-519. Anderson SJ, Barker PE, Hadfield MG. 2002. "Cytonectin expression in Alzheimer disease." Journal ofNeuropathology andExperimentalNeurology 61 (3): 230-236. Antonucci JM, Fowler BO, Dickens SH. 2002. "Interaction ofa silane coupling agent with dental monomers." Journal ofDentalResearch %\: A140. Anderson S J, Goley EM, Barker PE, Camphausen K. 2004. "Microarray analysis of gliosarcoma tissue." CheckSample Clinical Chemistry 44 (5): 51-61. Antonucci JM, Skrtic D. 2005. "Matrix resin effects on selected physicochemical properties of amorphous calcium phosphate composites." Journal ofBioactive and Compatible Polymers 20 (1): 29-49. Atha DH, Kasprzak W, O'Connell CD, Shapiro BA. 2001. "Prediction ofDNA single-strand DNA conformation polymorphism: analysis by capillary electrophoresis and computerized modeling." NucleicAcids Research 29 [l2): 4643-4653. Atha DH, Miller K, Sanow AD, Xu J, Hess JL, Wu OC, Wang W, Srivastava S, Highsmith WE. 2002. "High-throughput TRAP/PCR analysis oftelomerase using capillary electrophoresis." American Journal ofHuman Genetics 71 (4): 230. Atha DH, Miller K, Sanow AD, Xu J, Hess JL, Wu OC, Wang W, Srivastava S, Highsmith WE. 2003. "High-throughput analysis oftelomerase by capillary electrophoresis." Electrophoresis 24 (1-2): 109-114. Aumentado J, Keller MW, Martinis JM, Devoret MH. 2004. "Nonequilibrium quasiparticles and 2e periodicity in single-Cooper-pair transistors." PhysicalReviewLetters 92 (6): 066802. Babushok VI, Tsang W. 2003. "Gas-phase mechanism for dioxin formation." Chemosphere 51 (10): 1023-1029. Babushok VI, Linstrom PJ. 2004. "On the relationship between Kovats and Lee retention indices." Chromatographia 60 (1 1-12): 725-728. Bacolla A, Jaworski A, Connors TD, Larson JE, Jakupciak JP, O'Connell C, Wells RD. 2002. "PKDl unusual DNA conformations are recognized by nucleotide excision repair." The FASEB Journal 16 (4): A532. Bailey LO, Washburn NR, Simon CG, Chan ES, Wang FW. 2004. "Quantification of inflammatory cellular responses using real-time polymerase chain reaction." Journal of Biomedical Materials Research PartA 69A (2): 305-313. Bailey LO, Washburn NR, Wang FW. 2004. "Quantification ofinflammatory responses using real timePCR." MolecularBiology^ ofthe Cell \5: 375A. Bailey LO, Lippiatt S, Biancanello FS, Ridder SD, Washburn NR. 2005. "The quantification of cellular viability and inflammatory response to stainless steel alloys." Biomaterials 26 (26): 5296 5302. 4 Baker-Jarvis J, Kabos P. 2001. "Dynamic constitutive relations forpolarization and magnetization." PhysicalReview. E, Statistical, Nonlinear, andSoft MatterPhysics 64 (5 Pt 2): 056127. Baker-Jarvis J, Kabos P, HoUoway CL. 2004. "Nonequilibrium electromagnetics: Local and macroscopic fields and constitutive relationships." PhysicalReview. E, Statistical, Nonlinear, and SoftMatterPhysics 70 (3 Pt 2): 036615. Baker-Jarvis J. 2005. "Time-dependent entropy evolution in microscopic and macroscopic electromagnetic relaxation." PhysicalReview. E, Statistical, Nonlinear, andSoft MatterPhysics 72(6Pt2): 066613. Baker SC, Bauer SR, Beyer RP, Brenton JD, Bromley B, Burrill J, Causton H, Conley MP, Elespum R, Fero M, Foy C, Fuscoe J, Gao XL, Gerhold DL, Gilles P, Goodsaid F, Guo X, Hackett J, Hockett RD, Ikonomi P, Irizarry RA, Kawasaki ES, Kaysser-Kranich T, Kerr K, Kiser G, Koch WH, Lee KY, Liu CM, Liu ZL, Lucas A, Manohar CF, Miyada G, Modrusan Z, Parkes H, Puri RK, Reid L, Ryder TB, Salit M, Samaha RR, ScherfU, Sendera TJ, Setterquist RA, Shi LM, Shippy R, Soriano JV, Wagar EA, Warrington JA, Williams M, Wilmer F, Wilson M, Wolber PK, Wu XN, Zadro R. 2005. "The external RNA controls consortium: a progress report." Nature Methods 2 (10): 731-734. Ballou S, Goodpaster J, MacCrehan W, Reeder D. 2003. "Forensic analysis." Analyticaland Bioanalytical Chemistry 376 (8): 1149-1150. Balss KM, Ross D, Begley H, Olsen HG, Tarlov MJ. 2004. "DNA hybridization assays using temperature gradient focusing and peptide nucleic acids."Journal oftheAmerican Chemical Society 126: 134746-13479. Balss KM, Ross D, Tarlov MJ. 2003. "Temperature fradient focusing ofmatched and partially mismatched DNA/PNA hybridizations." Micro TotalAnalysis Systems 2003 Proceedings ofthe mTas 2003 Symposium: 1 141-1 144. Balss KM, Vreeland WN, Phinney KW, Ross DJ. 2004. "Resolution opfimization with chiral temperature gradient focusing." Proceedings Micro TotalAnalysis Systems 2004 Proceedings of the mTas 2004 Symposium 661-663. Balss KM, Vreeland WN, Phinney KW, and Ross DJ. 2004 "Simultaneous concentration and separation ofenantiomers with chiral temperature gradient focusing." Analytical Chemistry 76: 7243-7249. Bardo AM, DeJong ES, Goldner LS, Marino JP, Heinz WF, Weston KD. 2002. "Spectroscopic rulers: Distance and dynamics ofRNA binding using single molecule FRET." Biophysical Journal S2 (\): 49A. Bardo AM, DeJong ES, Yim PB, Marino JP, Goldner LS. 2003. "Rotational dynamics ofsurface RNA tethered via single molecule polarization modulation microscopy." BiophysicalJournal 84 300A. (2): DNA Barker PE. 2002. "Cell and standards for medical genetics laboratories." Journal of Association ofGenetic Technologists 28(2): 47-49. Barker PE, Pinsky P, Wang W, Srivastava S, Hocker D, Wu X, Spitz MR. 2002. "Estimates of consensus in cell selection and scoring ofFISH data." American Journal ofHuman Genetics 71 (4): 222. Barker PE, Watson MS, Ticehurst JR, Colbert JC, O'Connell CD. 2002. "NIST physical standards for DNA-based medical testing." Journal ofClinicalLaboratoryAnalysis 16 (1): 5-10. Barker PE. 2003. "Cancer biomarker validation: standards and process: roles for the National Institute ofStandards and Technology (NIST)." Annals oftheNew YorkAcademy ofSciences 983: 142-150. Barker PE, Wang W, Wagner PD, Pinsky P. 2004. "Inter-rater agreement on chromosome 5 breakage in FISH-based mutagen sensitivity assays (MSAs)." Mutation Research-Genetic Toxicology andEnvironmental Mutagenesis 562 (1-2): 133-142. Barrett MD, Chiaverini J, Schaetz T, Britton J, Itano WM, Jost JD, Knill E, Langer C, Leibfried D, Ozeri R, Wineland DJ. 2004. "Deterministic quantum teleportation ofatomic qubits." Nature 429 (6993): 737-739. Bartels A, Diddams SA, Ramond TM, Hollberg L. 2003. "Mode-locked laser pulse trains with subfemtosecond timingjitter synchronized to an optical reference oscillator." Optics Letters 28 (8): 663-665. Bartels A, Newbury NR, Thomann I, Hollberg L, Diddams SA. 2004. "Broadband phase-coherent optical frequency synthesis with actively linked Ti:sapphire and Cr:forsterite femtosecond lasers." Optics Letters 29 {A): 403-405. Bartels A, Oates CW, Hollberg L, Diddams SA. 2004. "Stabilization offemtosecond laser frequency combs with subhertz residual linewidths." Optics Letters 29 (10): 1081-1083. Batinic-Haberle I, Okado-Matsumoto A, Spasojevic I, Hambright P, Stevens RD, Neta P, MN Fridovich T. 2003. "Recent advances in the synthesis and characterization of water-soluble porphyrin-based catalytic antioxidants." FreeRadicalBiology andMedicine 35: S17-S18. Batinic-Haberle I, Spasojevic I, Stevens RD, Hambright P, Neta P, Okado-Matsumoto A, Fridovich I. 2004. "Improving bioavailibility ofSOD mimics." Free RadicalBiology and Medicine 37: S19-S20. Bauer BJ, Byrd HC, Guttman CM. 2002. "Small angle neutron scattering measurements of synthetic polymer dispersions in matrix-assisted laser desorption/ionization matrixes." Rapid Communications in Mass Spectrometry \6 (15): 1494-1500. 6