Zootaxa 4651 (3): 497–512 ISSN 1175-5326 (print edition) Article ZOOTAXA https://www.mapress.com/j/zt/ Copyright © 2019 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4651.3.5 http://zoobank.org/urn:lsid:zoobank.org:pub:41C656AB-5FEB-4714-9B80-3A5B5501A95B A new species of the fish genus Arctozenus from the Kerguelen Islands, with comments on the lost teeth in adults (Aulopiformes: Paralepididae) HSUAN-CHING HO1,2,4 & GUY DUHAMEL3 1National Museum of Marine Biology & Aquarium, Pingtung, Taiwan 2Institute of Marine Biology & Aquarium, National Dong Hwa University, Pingtung, Taiwan 3Muséum national d’Histoire naturelle, UMR BOREA (MNHN, Sorbonne Université, Université de Caen Normandie, Université des Antilles, CNRS, IRD), Paris, France 4Corresponding author. E-mail: [email protected] Abstract A new cryptic species of spotted barracudina, Arctozenus australis sp. nov., is described from the Kerguelen Islands, in the Indian Ocean sector of the Southern Ocean. It differs from the only congener, Arctozenus risso (Bonaparte, 1840), in the reduction of pigments on body, a more slender body, and longer head, snout and jaws. A neotype is designated for Paralepis risso Bonaparte, 1840 and Paralepis borealis Krøyer in Gaimard (1847). Note on synonymy of Paralepis risso is provided. Observation of adults of Notolepis annulata, Magnosudis prionosa and Paralepis coregonoides found loss of teeth on jaws and gill arches, suggesting more species in the subfamily Paralepidinae may commonly possess this character in adults. Key words: Pisces, taxonomy, Arctozenus risso, Arctozenus australis, Arctic, Southern Ocean Introduction During a recent visit by the first author to the Muséum national d'Histoire naturelle fish collection, a number of specimens either unidentified or only with rough identification in the family Paralepididae were examined. Among the specimens provisionally identified as Arctozenus risso (Bonaparte, 1840) there were several obviously different species, including some misidentifications of other genera and species. Detailed examination on the materials come from two geographical areas, the North Atlantic, and the Kerguelen Islands, Indian Ocean sector of the Southern Ocean, revealed two different species of Arctozenus. The genus Arctozenus was established by Gill (1864) for Paralepis borealis Krøyer in Gaimard (1847), a junior synonym of A. risso (see Post, 1972:145) and also a junior homonym of Paralepis borealis Reinhardt, 1837 (= Paralepis coregonoides Risso, 1820). Another available generic name Profundisudis was established for Paralepis coruscans Jordan & Gilbert, 1881 as a subgenus under Notolepis by Harry (1953). Post (1972) noted that Harry (1953) reassigned Paralepis risso to Notolepis, a decision which threatened the validity of Notolepis. A request had been sent to ICZN to place Arctozenus on the official Index of Rejected and Invalid Names in Zoology, but appeared not to have been accepted. Arctozenus (Profundisudis is junior synonym) and Notolepis are currently recognized as distinct genera with their own type species (Post, 1987) and there is unlikely to be confusion. Among the synonyms of A. risso, three species were described on the basis only of figures, four of them do not have primary types, and only the holotype of Paralepis coruscans is extant. All these synonyms have been assigned to a single species, the oldest available name, Paralepis risso Bonaparte, 1840 (= Arctozenus risso). However, the status of some of them are still doubtful. By comparing large numbers of specimens from a wide geographical spread, and data from previous reliable references, we recognized a new species from Kerguelen Islands, originally identified as A. risso (see Duhamel et al., 2005), but differs from the real A. risso in several aspects. A discussion of the synonyms of Paralepis risso Bonaparte, 1840 is provided. Other specimens examined in the MNHN collection were identified as species of Paralepis, Magnisudis and Notolepis. We found one example in each genus that exemplifies the loss of jaw teeth in adults. A detail description of each species example is provided. Accepted by W. Holleman: 20 Jun. 2019; published: 6 Aug. 2019 497 Materials and methods Specimens examined are held at the Muséum national d'Histoire naturelle (MNHN) and Zoological Museum, University of Copenhagen, Copenhagen (ZMUC). They were collected during midwater research cruises, or as by-catch of fishery operations (bottom trawl). Additional otolith collections were also available from unretained specimens. Measurements were made point to point, except where otherwise indicated. Standard length (SL), measured from tip of the upper jaw to base of caudal fin (posterior margin of hypural plate), is used throughout. Head length (HL), is measured from tip of snout to posterior margin of opercle. Head depth is the vertical depth hrough middle of eye. Body depth is measured at the greatest depth. Predorsal, prepelvic and preanal lengths are measured from tip of snout to origins of these fins, respectively. Snout length is measured from tip of snout to anterior margin of orbit. Eye diameter is the horizontal bony width of orbit. Interorbital width is the narrowest width of upper margins of eyes. Upper-jaw length is measured from tip of snout to posterior end of maxilla. Lower-jaw length is measured from tip of lower jaw to posterior end of articular bone (usually right below the middle of eye). Anal-fin base is measured from base of first ray to the insertion of the last ray. Caudal peduncle depth is the narrowest distance between upper and lower margin; caudal peduncle length is the vertical distance between end of anal-fin base and caudal-fin base. Lateral-line scales are counted to origins of dorsal, pelvic, anal fins and the total number. Vertebral numbers are shown as prehaemal, predorsal, prepelvic, preanal, caudal and total vertebrae. Comparisons are done with those provided in Post (1987), unless otherwise indicated. Abbreviations: DFO = Dorsal-fin origin; VFO = Pelvic-fin origin; AFO = Anal-fin origin; D‒V = horizontal distance between origins of dorsal and pelvic fins; D‒A = horizontal distance between origins of dorsal and anal fins. The COI sequences of mtDNA region were assembled and aligned and Pair-wise Kimura 2-parameter distance (K2P) genetic distance was calculated by using MEGA 7.0 (MEGA 7.0.21 version) (Kumar et al., 2016). A neighbour-joining (NJ) phylogenetic tree of the K2P with 1000 bootstrapping replications was also constructed by using same program. Taxonomy Subfamily Paralepininae (sensu Post, 1987) Arctozenus Gill, 1864 Diagnosis. Body covered by cycloid scales, moderately stout to slender; VFO behind vertical of DFO; gill rakers with multiple rows of short teeth, which never slender or needle-like; scales on body smaller than lateral-line scales; teeth on anterior portion of palatine enlarged and fang-shape; two rows of tooth pairs on lower jaw. Note on synonymy of Paralepis risso Bonaparte, 1840. Six available names are associated with Arctozenus and all are currently recognized as Arctozenus risso (Bonaparte, 1840) (Post, 1987). The original description of Paralepis risso Bonaparte, 1840 was based on description and a drawing by Cuvier in Cuvier & Valenciennes (1829:357‒359, pl. fig. 66; reproduced in Fig. 1A). The specimen was collected from Mediterranean Sea off Italy and apparently lost (Post, 1972:143). Richardson (1845:51, pl. 30, figs. 6‒7) described Prymnothonus hookeri based on drawing of a figure “provided by Dr. Hooker” without voucher and locality. They also mentioned: “It is evidently a Muraenoid fish, closely allied to the Congers.” Post (1972:157) suggested that “Dr. Hooker’s specimen cannot be assigned with any certainty to any nominal species. Apparently it was a postlarval paralepidid, probably either N. rissoi or P. coregonoides borea- lis or P. atlantica.” The species is treated herein as incertae sedis in Paralepididae. Krøyer in Gaimard (1842–1856) provided a drawing which he recognized as Paralepis borealis (although not specified, it is assumed to be Pl. 16B, fig. 1). However, the voucher appears not to have been retained. Gill (1864) established the new genus Arctozenus based on this drawing. Post (1972) recognized that the drawing was actually a Paralepis risso (as rissoi). Paralepis borealis Reinhardt, 1837 he recognized as a subspecies of Paralepis core- gonoides, and later synonymized with that species (Post, 1973, 1987). Examination on the holotype of Paralepis coregonoides borealis Reinhardt, 1837 (ZMUC P.2348432) has confirmed the synomyzation of these two names. According to the Code (ICZN, online version), the name Paralepis borealis of Krøyer in Gaimard (= A. risso) is treated as available (Article 11.10), and should be the type species of Arctozenus (Article 69.2.4). 498 · Zootaxa 4651 (3) © 2019 Magnolia Press HO & DUHAMEL Jordan & Gilbert (1881) described Paralepis coruscans based on a single specimen collected from the north- eastern Pacific Ocean. The fish is well described and illustrated. Rofen (1966) synonymized the species with N. rissoi (= A. risso), a decision supported by Post (1972, 1987). The holotype has a relatively deep body (13 times in fork length in original description) and we concur with this decision. Lütken (1892) described Paralepis kroyeri based on a drawing by Krøyer in Gaimard (1842-1856, pl. 16B, fig. 1). This is evidently the same species described by Krøyer. The species has sometimes been treated as a valid subspecies (i.e. Rofen, 1966), however, Post (1968, 1987) has suggested latitude-related changes in morphometrics and meristics, and synonymized it with A. risso. Whitley & Phillipps (1939) described Prymnothonoides regani, new genus and new species, based on a draw- ing of a juvenile collected at Cape Maria van Diem (northern tip of North Island, New Zealand) provided in Regan (1916: pl. VII, fig. 3). Harry (1953) placed the genus under Notolepis with a question mark and without further dis- cussion. In his catalogue of types, Post (1972) records that “Regan’s figure cannot be assigned with any certainty to any nominal species” and “The International Commission of Zoological Nomenclature has been requested to place the generic and specific name on the Official Index of Rejected and Invalid Names in Zoology.” However, the later seems never been gazettes and published, and Post (1973) later suggested that the species is questionably a synonym of Notolepis risso (Bonaparte, 1840). The species is treated herein as incertae sedis in Paralepididae. Arctozenus risso (Bonaparte, 1840) English name: Spotted barracudina Figs 1A–C, 2A,B, 3A,B, 5A,B; Table 1 Paralepis isso Bonaparte, 1840: pl. 124, fig. 2 (No types known; neotype designated herein). Paralepis kroyeri Lütken, 1892:228 (No types known; neotype designated herein). Paralepis coruscans Jordan & Gilbert, 1881:411 (Type locality: Port Townsend harbor, Washington, U.S.A.). Designation of neotype. According to Post (1972), there is no type for Paralepis risso Bonaparte, 1840 or Paral- epis borealis Krøyer in Gaimard (1847). A neotype is designated for both in order to stabilize the diagnosis of the species, according to Article 75.3 of The International Code of Zoological Nomenclature (ICZN, online version). Neotype. MNHN 2018-0264 (266 mm SL), out of MNHN 2000-5431, “Thalassa” station b229, 62°16’58.8”N, 10°10’1.2”W, off Faroe Islands, North Atlantic Ocean, 676‒696 m, 11 May 1975; also designated as neotype of Paralepis borealis Krøyer in Gaimard, 1847. Non-types. All from Atlantic Ocean. MNHN 2000-5429 (3, 256‒258) “Thalassa” station b570fq109, and MNHN 2000-5430 (4, twisted), 46°51’00”N, 59°37’1.2”W, 384‒384, 28 Jul. 1975. MNHN 2000-5431 (27, 212‒ 280), “Thalassa”, station b229, collected with neotype. MNHN 2000-5432 (26, 191‒250), “Thalassa”, station b230, 62°25’1.2”N, 9°33’00”W, 566‒588 m, 12 May 1975. MNHN 2000-5433 (2, 226‒236), “Thalassa”, station b328fq67, 50°37’1.2”N, 53°33’00”W, 311‒312 m, 20 Jul. 1975. MNHN 2000-5434 (1, 261), “Thalassa”, station b346fq85, 49°28’1.2”N, 50°12’00”W, 320‒322 m, 22 Jul. 1975. MNHN 2000-5435 (1, 235), “Thalassa”, station b344fq83, 49°3 4’1.2”N, 50°16’1.2”W, 336‒382 m, 22 Jul. 1975. MNHN 2000-5436 (1, 253), “Thalassa”, station b322fq61, 53°9’00”N, 51°58’58.8”W, 940 m, 17 Jul. 1975. MNHN 2000-5437 (1, 267), “Thalassa”, station b228, 62°43’1.2”N, 9°39’00”W, 494‒502 m, 11 May 1975. MNHN uncat. (1, 199, photo only), tissue no. BPS-1960, 45°56’N, 4°16’, Bay of Biscay, France, northeast Atlantic Ocean, 20 Oct. 2011. Diagnosis. Body uniformly and densely covered with chromatophores; body depth 9‒16 times in SL, a short, deep head, depth at middle of eye 3.5‒4.1 in HL, VFO under dorsal-fin base, and anterior lateral-line scales subequal in depth and length. Description. Following data is for neotype with of non-types (n = 54) in parentheses, except where otherwise indicated. Dorsal-fin rays 9 (9‒10, usually 9); pectoral-fin rays 13 (13‒14, usually 13); pelvic-fin rays 9 (9‒10, usually 9); anal-fin rays 31 (30–33). Vertebrae (n=15): prehaemal 39 (39–41), caudal 46 (43–46), predorsal 37 (37–39), prepelvic 40 (40‒43), preanal 54 (52–56), and total 85 (83–87). Gill rakers 8 (7–10) on upper limb, 27 (28–31) on lower limb, 11 (11–13) on ceratobranchial, 16 (14–18) on hypobranchial. Lateral-line scales: predorsal 38 (37–39), prepelvic 40 (40–42), preanal 53 (52–55), total 66 (65‒70). A NEW ARCTOZENUS FROM THE KERGUELEN ISLANDS Zootaxa 4651 (3) © 2019 Magnolia Press · 499 FIGURE 1. A‒C. Arctozenus risso (Bonaparte, 1840). A. Original drawing which Paralepis risso Bonaparte, 1840, reproduced from Cuvier in Cuvier & Valenciennes, 1829: pl. fig. 66). B. Neotype of Paralepis risso Bonaparte, 1840, MNHN 2018-0246. C. MNHN uncat. (tissue no. BPS-1960), 199 mm SL, photo by Samuel Iglésias. D‒E. Arctozenus australis sp. nov. D. Holotype, MNHN 2000-0260. E. Fresh condition, one of paratypes. Body elongate and compressed in individual smaller than 250 mm SL, becoming stouter and thicker in specimens more than 250 mm SL, greatest depth 11.2 in SL (9.5‒13.0 in specimens >250 mm SL; 12.9‒15.8 in specimens <250 mm). Caudal peduncle subequal to eye diameter. Posterior half of abdomen with slightly developed flap. Ventral adipose fin absent. Head moderately long, pointed (Fig. 2A), its length 4.9 (4.6‒5.0) in SL, its depth slightly (<250 mm SL) to much lower (>250 mm SL) than the trunk. Mouth terminal, slender, its gape extends to about one eye diameter in front of the eye; lower jaw not upturned at tip, its tips bearing a black non-ossified tissue. Eye large, bony diameter 5.9 (5.4‒6.6) in HL. First suborbital bone slightly expanded anteriorly, second long, about twice the third, third to fifth stout, the sixth well expanded dorsally. Interorbital space narrow and flat, its width 8.5 (8.5–9.8) in HL. Two ridges on each side of interorbital space, the inner one extended forward to tip of snout. Premaxilla rectangular, 500 · Zootaxa 4651 (3) © 2019 Magnolia Press HO & DUHAMEL closely attached to maxilla; maxilla extending to slightly, but clearly, less than one eye diameter in front of the eye. Two nostrils closed together, above tip of maxilla or slightly behind. Opercle with low ridges forming radiated pattern (when skin removed), posterior margin slightly indented. Tongue surrounded by narrow fleshy membrane. FIGURE 2. Comparison of head and relative position of DFO and VFO of A. risso and A. australis. A-B. Neotype of A. risso. C. Paratype of A. australis, MNHN 1992-1218. D. Holotype of A. australis. Bars indicate end of dorsal-fin base (upper) and origin of pelvic fin (below). A NEW ARCTOZENUS FROM THE KERGUELEN ISLANDS Zootaxa 4651 (3) © 2019 Magnolia Press · 501 FIGURE 3. Microscopy photographs of anterior trunk region (A, C) and close-up of above lateral line at same region (B, D). A–B. Neotype of A. risso. C–D. Holotype of A. australis. Both with complete skin, but most scales lost. DFO at about posterior third of standard length, predorsal length 1.5 (1.5‒1.6) SL. Pectoral fin above ventral margin, about lower level of gill cover, the uppermost ray at about same level of lower margin of eye. VFO below posterior half of dorsal-fin base, never behind that, pre-pelvic length 1.4 (1.4‒1.5) in SL. Anal fin originating at posterior sixth of standard length, pre-anal fin length 1.2 (1.2) in SL. Anal fin base short, 7.2 (6.7‒7.2) in SL. Dorsal adipose fin over posterior end of anal-fin, about 1.5 its base length before caudal-fin base, its base length less than eye diameter. Two to four small fangs at front of upper jaw, followed by a closet row of tiny blade-like teeth along maxilla. Vomerine teeth absent. Two rows of fangs on anterior palatines, in 5 or 6 (5‒8) widely-spaced pairs, those in outer row fixed and much smaller than those in inner row, which are depressible, the third or fourth especially enlarged, followed by single row of small fangs posteriorly. Two or three small fangs at front of lower jaws, followed by a short row of small teeth, then two rows of fangs posteriorly, forming 14 (10‒14) widely-spaced pairs, those in outer row fixed and smaller than those in inner row which are depressible. About 2 irregular rows of small teeth on each side of outer portion of tongue. Gill rakers as described by Post (1987, figs. 1c, d), present on most gill arches, shield-shaped, each with three or four rows of small teeth. Pharyngeal teeth from short, slender, forming two long patches, anterior patch long triangular with 3 irregular rows; posterior patch oval with up to 6 rows. About 10 scattered teeth on fifth ceratobranchial, in one irregular row. Gill filaments present on the first to fourth arches, absent on fifth. Anterior half of fifth gill arch connected to the forth by membrane. Pseudobranch present, in a shallow chamber above first gill arch. Body completely scaled, mostly lost leaving distinct pockets. Lateral-line scales originating from above pectoral girdle and running along upper third of the flank to above about over middle of anal-fin base. Anterior lateral-line scales about twice as long as its height, gradually becoming smaller and narrower posteriorly, but not to the degree as in members of Lestrolepinae; two large pores on posterior margin of each scale. Luminous organs absent. 502 · Zootaxa 4651 (3) © 2019 Magnolia Press HO & DUHAMEL Coloration (Figs. 1B,C, 2A,B, 3A,B). Preserved specimen with body generally blackish, densely covered with fine chromatophores; some much larger spots on dorsum and posterior half of body visible without magnification; dorsal surface of head and snout blackish; tips of jaws black. Gill chamber entirely blackish; mouth cavity mostly pale with irregular patches of fine chromatophores. Peritoneum black. All fins hyaline, except for pigmented upper rays of pectoral fin. Distribution. Circumglobal in temperate and tropical seas including the Arctic (Post, 1987), but probably not present in the Southern Ocean (see below). Remarks. The world distribution of this species is as provided by Post (1987) with one exception. In his list of specimens, one lot (WH247, 61°10’S, 56°07’W, 180 mm SL) was collected from Antarctic region (also see Post, 1987: fig. 2). We are not sure whether he measured this specimen so we could not judge this record. Post (1990) also recorded A. risso occurring in the Southern Ocean for which he recorded the body depth 5.9‒7.7% SL and head length 21.8‒27.5% SL which did not correspond with his previous data (Post, 1987: table 1). We believe this specimen to be the new species described below. Post (1987) divided the body depth of A. risso 8.0‒11.5% SL (30°S) or 8.5‒11.7% SL (30°N) which is similar to our specimens with body size more than 250 mm SL (7.7‒10.6% SL, n = 18), but not these smaller than 250 mm SL (6.3‒7.7%, n = 36). The presence of A. risso in Antarctic is doubtful. Arctozenus australis sp. nov. New English name: Southern spotted barracudina Figs. 1D,E, 2C,D, 3C,D, 4, 5A,B; Table 1 Holotype. MNHN 2000-0260 (281 mm SL), “La Curieuse” off Kerguelen Islands, “Icthyoker” cruise, International Young Gadoid Pelagic Trawl (IYGPT), station 44, 49°58’S, 71°48’E, 350 m, 13 Feb.1998. Paratypes. Thirteen specimens, 255‒287 mm SL. MNHN 1992-1217 (1, 265), “Skif” off Kerguelen Islands, SKALP cruise, 48°39’00”S, 71°01’58.8”E, Rectangular Midwater trawl (RMT) station 3, 600‒700 m, 28 Feb. 1988. MNHN 1992-1218 (2, 270‒280), “ Kalper” , SKALP cruise, Bottom trawl, 47°16’58.8”S, 70°46’58.8”E, 295 m, 27 Apr. 1988. Collected with “La Curieuse” off Kerguelen Islands, “Icthyoker” cruise, IYGPT, near the type locality at same period: MNHN 2000-0254 (1, 257), station 6, 50°22’S, 72°56’E, 345 m, 6 Feb.1998. 2000-0255 (1, 274), station 135, 48°36’S, 71°10’E, 378 m, 5 Mar.1998. 2000-0256 (1, 255), station 133, 48°35’S, 71°16’E, 188 m, 5 Mar.1998. 2000-0257 (1, 287), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-0258 (1, 261), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-0259 (1, 272), station 84, 49°12’S, 71°21’E, 205 m, 25 Feb.1998. 2000-0261 (1, 270), station 127, 49°02’S, 71°03’E, 420 m, 1 Mar.1998. 2000-0262 (1, 258), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-4962 (1, 275), station 452, 48°20’S, 71°55’E, 160 m, 1 Apr.1999. 2000-4969 (1, 291) station 508, 49°32’S, 71°03’E, 350 m, 20 Apr.1999. Non-types. Four specimens, 245‒270 mm SL. MNHN 1981-1251 (1, 245), “Vzmorie” 50°00’S, 70°49’58.8”E, Commercial bottom trawl, 250‒300 m, 5 Dec. 1980. MNHN 1999-1219 (2, 268‒270), “La Curieuse” off Kerguelen Islands, “Ipeker” cruise, IYGPT, station 32, 49°10’ 58.8”S, 71°16’58.8”E, 350 m, 4 Mar. 1995. MNHN 2004-1110 (1, damaged), same cruise as previous lot, station F3, 47°06’S, 74°37’E, 160 m, 17 Apr. 2000. MNHN 2011-0452 (broken, posterior part cut off for genetic analysis), “Poket 2” cruise, station 3, 46°24’14.4”S, 67°33’43.2”E, off Kerguelen Islands, 791‒792 m, 28 Aug. 2010; genetic voucher, field number POKER9202, BIN number BOLD: ABW7005. Diagnosis. A species of Arctozenus differing from the only congener in having a pale body with lower half mostly devoid of chromatophores; body slender, its depth 14‒19 in SL; a slender head, its depth at middle of eye 4.3‒5.1 in HL. Compared to similar size specimens (>250 mm SL) of A. risso, A. australis has relatively slender body (5.2‒7.3%, vs. 7.7‒10.6% SL); the ratio of snout length/eye diameter relatively large 3.1‒3.9 (vs. 2.7‒3.4); origin of pelvic fin slightly but clearly behind dorsal-fin base (vs. usually below dorsal-fin base); and anterior lateral-line scales long, about twice as long as its height (vs. width subequal to the height). Description. Following data are presented for holotype with paratypes in parentheses, except where otherwise indicated. Meristic values in square brackets are for all specimens, including 3 non-types when available; values were taken from both sides when paired. A NEW ARCTOZENUS FROM THE KERGUELEN ISLANDS Zootaxa 4651 (3) © 2019 Magnolia Press · 503 Dorsal-fin rays 9 [9(13), 10(1)]; pectoral-fin rays 12 [11(3), 12(22), 13(3)]; pelvic-fin rays 9; anal-fin rays 30 [30(5), 31(8), 32(2)]. Vertebrae: prehaemal 39 [38(5), 39(6), 40(4)]; caudal 43 [41(1), 42(5), 43(5), 44(3), 45(1)]; predorsal 37 [36(3), 37(7), 38(6) ]; prepelvic 41 [39(1), 40(5), 41(7), 42(2)]; preanal 53 [50(3), 52(8), 53(4), 54(1)]; and total 82 [79(1), 80(1), 81 (2), 82(8), 83(2), 84(1)]. Lateral-line scales: predorsal 36 [35(1), 36(8), 37(11), 38(16)]; prepelvic 40 [40(13), 41(8), 42(7)]; preanal 52 [51(6), 52(9), 53(10), 54(1) ]; total 63 [62(3), 63(9), 64(5), 65(7), 66(4) ]. Gill rakers 9 (7–10) on upper limb (epibranchial) and 35 (26–35) on lower limb, 13 (10–13) on ceratobran- chial and 22 (16–22) on hypobranchial. Body elongate, strongly compressed, depth at deepest area 14–19 times in SL. Caudal-peduncle length subequal to eye diameter. Posterior half of abdomen with slightly developed flap. No ventral adipose fin, but a low fleshy ridge behind the pelvic fin. Head slender, pointed, triangular in lateral view (Fig. 2C), its length 4.4 (4.2–4.6) times in SL, its depth slightly less than the depth of trunk. Mouth terminal, slender, its gape extends to slightly more than one eye diameter in front of the eye; lower jaw not upturned at tip, tip bearing a black non-ossified tissue. Eye relatively small, its diameter 6.9 (6.4‒7.3) in HL. First bone well-expended anteriorly, second long, about twice of the third, third to fifth stout, the sixth well-expanded dorsally. Interorbital space narrow, slightly concave, its width 11.3 (10.6–11.9) in HL. Two ridges on each side of interorbital space, inner one extends to tip of snout. Premaxilla rectangular, closely attached to maxilla; maxilla extends to about one eye diameter in front of the eye. Two nostrils closed together, both above tip of maxilla or slightly behind it. Opercle with low ridges under the skin forming radiated pattern, the posterior margin slightly indented. Tongue surrounded by narrow fleshy membrane. DFO at about posterior third of standard length, pre-dorsal length 1.5 in SL. Pectoral fin above the ventral margin, about lower level of gill cover, its uppermost ray at about same level of lower margin of eye. VFO slightly but clearly behind dorsal-fin base (Fig. 2D), pre-pelvic length 1.4 in SL. AFO at posterior fifth of body, pre-anal fin length 1.2 in SL. Anal-fin base short, 6.7 (6.3‒7.6) in SL. Dorsal adipose fin above rear end of anal-fin base, about 1.5 its base length before caudal-fin base, its base length less than eye diameter. Two or three small fangs anterior upper jaw, followed by a close set row of tiny blade-like teeth along maxilla. Vomerine teeth absent. Two rows of fangs on anterior palatines, in 7 or 8 widely-spaced pairs, those in outer row fixed and much smaller than those in inner row, those in inner row which are depressible, the second and third especially enlarged, followed by single row of smaller fangs. Two or three small fangs at anterior lower jaw, followed by a short row of small teeth, then two rows of fangs, in 7‒9 widely-spaced pairs, those in outer row fixed and much smaller than those in inner row which are depressible. About 2 irregular rows of small teeth on each side of outer portions of tongue. Gill rakers as described in Post (1987, figs. 1c, d), present along most gill arches, shield-shaped, each bearing three or four rows of small teeth, those in inner row longest. Pharyngeal teeth from short, slender, forming two long patches, anterior patch long, triangular with two irregular rows, posterior patch oval with up to 6 rows. Few scattered teeth on fifth ceratobranchial, in one row anteriorly, more irregular posteriorly. Gill filaments present on first to fourth arches, absent in fifth. Anterior half of fifth gill arch connected to forth arch by membrane. Pseudobranch present, as a shallow chamber above first gill arch. Body completely scaled, mostly lost, leaving distinct pockets. Lateral-line scales originating from above pectoral girdle and running along upper portion of flank to above about middle of anal-fin. Anterior lateral-line scales slightly more than twice length of height, gradually becoming smaller and narrower posteriorly, but not to the degree as Lestrolepinae; one large pore at each corner of posterior margin of scales; pair of smaller pores between or slightly in front of the lager pores; pair of small pores at middle of each scale; one (sometimes 0 or 2) small median pore at front of each scale. Luminous organs absent. Coloration (Figs. 1D,E, 3C,D). Fresh color silvery white. Most specimens with scales entirely lost; musculature milky white; slightly grayish dorsally and paler ventrally. Operculum black; snout and jaws irregularly blackish. Preserved specimens loosely covered by chromatophores and some much larger dots on upper half of body under the microscope; ventral half of body devoid of chromatophores, except for some scattered dots along the abdominal ridge. Dorsal surface of head and snout blackish; tips of jaws black. Gill chamber irregularly blackish; oral cavity mostly pale, blackish posteriorly. Peritoneum black. All fins hyaline, except for several upper rays of pectoral fin with pigment along inner surface. Size. The largest specimen examined is 291 mm SL; reaching 316 mm SL around the Kerguelen area (Duhamel et al., 2005). 504 · Zootaxa 4651 (3) © 2019 Magnolia Press HO & DUHAMEL Etymology. The specific name australis is Latin for “southern”, in reference to the distribution of the present species which appears restricted to the Southern Ocean. Distribution. Currently described from the Kerguelen Islands (Kerguelen Plateau) (Fig. 4), Indian sector of the Southern Ocean, but probably occurring in other parts the Southern Ocean (see Remarks). A thermal range for the species would be cool-temperate waters to south polar seas close to the Polar front. Specimens have been collected mainly offshore (over depths >500 m) by pelagic gear in the upper mesopelagic layer (160‒420 m) at night, sug- gesting diel vertical migration from deeper water. Some were by-catch of bottom trawl on the slope of the Kerguelen Plateau (480–800 m) (Duhamel & Hulley, 1993, Duhamel et al., 2005) and South-Georgia (Gregory et al., 2017). FIGURE 4. Distribution map of Arctozenus australis, including specimens from other cruises. COI DNA sequence. The following sequence was registered to Barcode of Life Data System (BOLD; bin number: BOLD:ABW7005) (http://www.boldsystems.org/). CCTCTACCTGTTATTTGGTGCTTGGGCCGGAA TAGTGGGCACAGCGTTAAGCCTACTTATTCGGGCAGAACTAAGCCAGCCCGGAGCCCTATTGGGTGAC GACCAAATTTATAATGTAATCGTAACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATACCTGTTAT GATTGGCGGTTTTGGAAATTGACTCATTCCCCTAATGATCGGGGCCCCCGACATAGCCTTCCCCCGAAT AAATAATATGAGCTTCTGACTTCTACCTCCATCTTTCCTCCTTCTCCTAGCTTCCTCTGCAGTAGAAGCC GGAGCCGGCACAGGGTGAACAGTGTATCCCCCTCTTGCCAGCAACTTAGCTCACGCTGGAGCCTCCG TTGACCTGACTATTTTTTCCCTTCACTTAGCAGGGATCTCCTCTATTTTAGGTGCTATTAATTTCATCACA ACTATTGTTAACATAAAACCACCTGCGATTACCCAATACCAGACTCCCTTATTCGTATGAGCGGTACTAA TCACCGCTGTACTTCTTTTACTTTCCCTCCCTGTCTTAGCAGCCGGAATTACGATACTTCTTACGGATCG GAATTTAAATACCAC Comparisons. The species is very similar to the widespread Arctozenus risso in body proportions and meristics. Post (1987) provided the evidence that vertebral numbers change with latitude, and the body shape changed with the spawning stage. Our specimens agreed well with the data from southern Atlantic Ocean (30°S south). However, by examining the specimens closely, we found compared to the similar size of A. risso, our specimens have a paler body (Fig. 2), more slender body, and longer head, snout and jaws (Table 1; Fig. 5) Specimens of A. australis examined were 255‒291 mm SL, whereas A. risso were 191‒280 mm SL in present study. Accordingly, the data set of the later is divided into two groups at 250 mm SL in order to compare the similar size of both species. Post (1987) provided data separated in two groups at ca. 140 mm SL for the Atlantic popula- tions from 30°S south and 30°N north, respectively. The specimens greater than 140 mm SL in these two geographic regions showed similar body proportions. A NEW ARCTOZENUS FROM THE KERGUELEN ISLANDS Zootaxa 4651 (3) © 2019 Magnolia Press · 505 Although all specimens have lost scales in the trawl, their skins are complete and scale pockets are detect- able. There are scattered chromatophores on upper half of body above the lateral line and almost entirely devoid of chromatophores on lower half of body in all individuals in A. australis (Figs. 3C, D). In contract, A. risso has entire body densely covered by chromatophores (Figs. 3A, B); while in smaller specimens, or individuals with most scales lost, the body will appear paler, there are always numerous melanophores around scale pockets visible under magnification. FIGURE 5. Comparison between two Arctozenus species. A. Body depth versus standard length; upper plots are original values (mm) and lower plots are % SL of specimens. B. Ratio of snout length/eye diameter versus standard length. In all individuals of A. australis examined by us, the VFO is slightly, but clearly, behind the dorsal-fin base; whereas the VFO is always below the posterior half of dorsal-fin base in A. risso (see Fig. 2D vs 2B). The body is relatively slender in A. australis than in A. risso (Table 1, Fig. 5A). In specimens of A. risso <250 mm SL, the body is relatively slender (body depth 6.3‒7.7% SL), becoming distinctly deeper (7.7‒10.6% SL) when >250 mm SL. In all specimens of A. australis, the body depth is clearly narrower (5.2‒7.3% SL) than that of A. risso with body size >250 mm SL (Fig. 5A). 506 · Zootaxa 4651 (3) © 2019 Magnolia Press HO & DUHAMEL