JournalofVirologicalMethods234(2016)34–42 ContentslistsavailableatScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Evaluation of two singleplex reverse transcription-Insulated isothermal PCR tests and a duplex real-time RT-PCR test for the detection of porcine epidemic diarrhea virus and porcine deltacoronavirus JianqiangZhanga,∗,Yun-LongTsaib,Pei-YuAlisonLeeb,QiChena,YanZhangc, Cheng-JenChiangb,Yu-HanShenb,Fu-ChunLib,Hsiao-FenGraceChangb, PhillipC.Gaugera,KarenM.Harmona,Hwa-TangThomasWangb aDepartmentofVeterinaryDiagnosticandProductionAnimalMedicine,IowaStateUniversity,Ames,IA,USA bGeneReachU SA ,Lexington ,MA,USA cAnimalDise aseD iagnosticL abo ratory,OhioDepartmentofAgriculture,Reynoldsburg,OH,USA a b s t r a c t Articlehistory: Recentoutbreaksofporcineepidemicdiarrheavirus(PEDV)andporcinedeltacoronavirus(PDCoV)in Receiv ed20November2015 multipl ecountries h avecaus edsignific antecono micl ossesan dre mainas eriouschallenget otheswi ne AReccceepivteedd i2n8 r Mevaisrechd 2fo0r1m 6 2 March 2016 iPnEdDuVstaryn. d RPapDiCdo dViaog untobsries a isk cs.riItnics aull afoter dthies oimt hpelremmaelnPtCa tRio(nii PoCf eRf)fioc nientht ecopn otr rtoalb slteraPt OegCiKeIsT bTeMfodr eev a inced di suurisnegr Availableonline6April2016 friendlyforon-sitepathogendetection.Inthepresentstudy,asingleplexPEDVRT-iiPCR,asingleplex PDCoVRT-iiPCR,andaduplexPEDV/PDCoVreal-timeRT-PCR(rRT-PCR)commercialreagentstargeting Keywords: theMgenewerecomparedtoanNgene-basedPEDVrRT-PCRandanMgene-basedPDCoVrRT-PCRthat Porcineepidemicdiarrheavirus werepreviouslypublishedandusedasreferencePCRs.AllPCRassayswerehighlyspecificanddidnot Porcinedeltacoronavirus PEDV cross react with other porcine enteric pathogens. Analytical sensitivities of the PEDV RT-iiPCR, PDCoV PDCoV RT-iiPCRandduplexPEDV/PDCoVrRT-PCRweredeterminedusinginvitrotranscribedRNAaswellas iiPCR viralRNAextractedfromten-foldserialdilutionsofPEDVandPDCoVcellcultureisolates.Performanceof Duplexreal-timeRT-PCR eachPCRassaywasfurtherevaluatedusing170clinicalsamples(86fecalswabs,24feces,19intestines, and41oralfluids).ComparedtothereferencePEDVrRT-PCR,thesensitivity,specificityandaccuracyof thePEDVRT-iiPCRwere97.73%,98.78%,and98.24%,respectively,andthoseoftheduplexPEDV/PDCoV rRT-PCRwere98.86%,96.34%,and97.65%,respectively.ComparedtothereferencePDCoVrRT-PCR,the sensitivity,specificityandaccuracyofthePDCoVRT-iiPCRwere100%,100%,and100%,respectively,and thoseofthePEDV/PDCoVduplexrRT-PCRwere96.34%,100%,and98.24%,respectively.Overall,allthree newPCRassayswerecomparabletothereferencerRT-PCRsfordetectionofPEDVand/orPDCoV.The PEDVandPDCoVRT-iiPCRsarepotentiallyusefultoolsforon-sitedetectionandtheduplexPEDV/PDCoV rRT-PCRprovidesaconvenientmethodtosimultaneouslydetectthetwovirusesanddifferentiatePEDV fromPDCoV. ©2016ElsevierB.V.Allrightsreserved. 1. Introduction Coronaviridae. Four genera, Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus, have been described Coronaviruses(CoVs)areenveloped,single-stranded,positive- (Wooetal.,2010,2012).Inpigs,fiveCoVshavesofarbeeniden- sense RNA viruses in the order Nidovirales and the family tifiedandtheseinclude:porcineepidemicdiarrheavirus(PEDV), transmissiblegastroenteritisvirus(TGEV)andporcinerespiratory coronavirus(PRCV)intheAlphacoronavirusgenus;porcinehemag- glutinatingencephalomyelitisvirus(PHEV)intheBetacoronavirus ∗ Correspondingauthorat:DepartmentofVeterinaryDiagnosticandProduc- genus; and porcine deltacoro navir us (PDC oV ) in the Deltacoro- tionAnimalMedici ne,Coll ege ofVeterinary M edicine,Iow aStateUni vers ity,1800 navirus gen us. PEDV , TGEV and PDC oV prima rily cau se enteric Chri stensen Drive,Am es,IA50 01 1,USA. E-mailaddress:[email protected](J.Zhang). http://dx.doi.org/10.1016/j.jviromet.2016.03.016 0166-0934/©2016ElsevierB.V.Allrightsreserved. J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 35 infectionsinpigs;PRCVhasapredilectionfortherespiratorytract; pigs(Lungetal.,2015)andvariouspathogensinshrimp,dogs,cats, PHEVinfectionproducesencephalomyelitisratherthanenteritis. andhorses(Balasuriyaetal.,2014;Tsaietal.,2012a,2014;Wilkes PEDVwasfirstidentifiedinEnglandinthe1970sandhassince etal.,2015a,b,2014a). spread to oth er E uropean a nd Asian cou ntr ies (So ng a nd Park, In theprese ntstudy,commercialRT-iiPCRonPOCKITTMmeth- 2012). InO ctobe r2010,the PED Vstrai nscirculati nginC hina were ods(P OCK ITTMPE DVRea gentSetand POCKITTM PD CoVReagentSet, reportedtohavebecomemorevirulentthanclassicalPEDVstrains, GeneReachUSA,Lexington,MA,USA)availableforon-sitedetec- withsomecausingupto100%morbidityandhighmortalityinsuck- tionofPEDVandPDCoV,respectively,wereevaluated.Inaddition, lingpiglets(Lietal.,2012;Sunetal.,2012).InApril2013,PEDV acommercialduplexrRT-PCRtest(IQREALPEDV/PDCoVQuantita- emergedinUnitedStates(U.S.)swineandcausedsevereillnessand tiveSystem,GeneReachUSA)availableforsimultaneousdetection highmortalityinpiglets(Stevensonetal.,2013).Sequenceanalyses anddifferentiationofPEDVandPDCoVwasevaluatedaswell.Ana- revealedthattheU.S.virulentPEDVs(U.S.PEDVprototypestrain) lyticalsensitivity,specificity,andclinicalperformanceofthethree are most genetically similar to the Chinese virulent PEDV strain newlyestablishedassayswerecomparedwiththepreviouslypub- AH2012 (Chen et al., 2014; Huang et al., 2013; Stevenson et al., lishedsingleplexPEDVrRT-PCR(Loweetal.,2014;Madsonetal., 2013).InJanuary2014,amildlyvirulentPEDVvariantwasidenti- 2014;Thomasetal.,2015)andsingleplexPDCoVrRT-PCRassays fiedintheU.S.thathadinsertionsanddeletionsinthespikegene (Chenetal.,2015). (U.S.S-INDEL-variantstrain)comparedtothevirulentU.S.PEDV prototype strain (Chen et al., 2016a; Vlasova et al., 2014; Wang 2. Materialsandmethods etal.,2014b).SinceitsemergenceintheU.S.inApril2013,PEDV hasspreadrapidlyacrossthecountryandresultedintheestimated 2.1. Virusesandotherentericpathogens deathof8millionpigsinthefirstyear,causingeconomiclossesof $900millionto$1.8billion(Paarlberg,2014).Inaddition,PEDVhas Isolation and characterization of the U.S. PEDV prototype recentlyalsoemergedorre-emergedinChina,Japan,SouthKorea, isolate USA/IN19338/2013, U.S. PEDV S-INDEL-variant isolate Philippines,Thailand,Vietnam,Canada,Mexico,Germany,Belgium, USA/IL20697/2014,andU.S.PDCoVisolateUSA/IL/2014werepre- FranceandPortugal(Graslandetal.,2015;Mesquitaetal.,2015; viouslydescribed(Chenetal.,2015,2014,2016b).Foranalytical Pasicketal.,2014;Puranavejaetal.,2009;SongandPark,2012; sensitivity analysis, PEDV and PDCoV cell culture isolates were Stadleretal.,2015;Theunsetal.,2015;Vlasovaetal.,2014;Vui 10-fold serially diluted in minimum essential medium and sub- et al., 2015). Currently, PEDV remains a significant threat to the jectedtoRNAextractionandPCRtesting.Inordertodeterminethe globalswineindustry. specificity of the PEDV and PDCoV RT-PCR assays, other porcine Porcinedeltacoronaviruswasfirstdetectedinpigsamplescol- entericpathogenswereincludedinthestudy:TGEVPurduestrain lectedin2009byaHongKonggroup(Wooetal.,2012).IntheU.S., (ATCC VR-763), TGEV Miller strain (ATCC VR-1740), PRCV ISU-1 PDCoVwasfirstreportedinearly2014(Lietal.,2014;Marthaler strain,PHEVMenglingstrain(NVSL001-PDV),porcinerotaviruses etal.,2014;Wangetal.,2014a)butPCR-basedretrospectivetesting (groupsA–C),Escherichiacoli,Salmonellatyphimurium,Clostridium indicatedthatPDCoVwaspresentinU.S.swineatleastfromAugust difficile,Clostridiumperfringens,Brachyspirahyodysenteriae(B204), 2013(Sinhaetal.,2015).PathogenicityofPDCoVhasbeenexperi- andLawsoniaintracellularis. mentallyconfirmedinpigs(Chenetal.,2015;Jungetal.,2015;Ma etal.,2015).RecentlyPDCoVhasalsobeenreportedinSouthKorea 2.2. Clinicalsamples andChina(LeeandLee,2014;Songetal.,2015). InfectionwithPEDV,PDCoVandTGEVcanleadtosimilarclinical Atotalof170clinicalsamples(86fecalswabs,24feces,19small symptomsincludingdiarrhea,dehydration,variablevomiting,and intestinesand41oralfluids),submittedtotheIowaStateUniversity highmortalityespeciallyinneonatalpiglets.Theseclinicaldiseases VeterinaryDiagnosticLaboratory(ISUVDL)andtestedforPEDVand andlesionsareindistinguishableandspecificlaboratorydiagnos- PDCoVbyvirus-specificRT-PCRs,wereselectedtodeterminethe tic testing is imperative to differentiate PEDV, PDCoV and TGEV performance of various PEDV and PDCoV PCRs evaluated in this infection. However, prevalence of TGEV in the swine population study. hasbeenverylowinrecentyearsbasedondatafromvariousvet- erinarydiagnosticlaboratories(unpublished)whiledetectionand 2.3. Nucleicacidextraction differentiationofemergingPEDVandPDCoVhavebecomecritical. Polymerasechainreaction(PCR)isarapid,sensitiveandspecific Nucleicacidswereextractedfromvirusisolatesandtheirdilu- tool and is curren tly mos t com mo n ly use d for det ectin g PEDV tions(50(cid:2) l),bac terial isolates(5 0(cid:2)l), small intestin ehom ogen ates and PDCo V fromclini calsam ples.Anu mber ofr eal-timer everse (50(cid:2) l),o ralfl uids(100 (cid:2)l),pro ces sed feces orfecals wabs(100(cid:2)l) tran scriptio n PCR (rRT-P CR) assay s have bee n d eveloped for the usin ga Mag MAXT MPat hog enRNA/DN AKit (T herm oFishe rSci en- detectionofPEDV(Alonsoetal.,2014;Jungetal.,2014;Kimetal., tific,Waltham,MA,USA)andaKingfisher-96instrument(Thermo 2007;Loweetal.,2014;Opriessnigetal.,2014;Thomasetal.,2015) Fisher Scientific) following the instructions of the manufacturer. andPD CoV( Ch en etal., 2015;Mart ha ler etal.,2 014).A sp ike gene- Nuclei cacidswer eelutedin to9 0(cid:2)lofElutio nb uffe r. based real-time RT-PCR has also been described to differentiate Nucleicacidswerealsoextractedfromclinicalsamples(fecal theU. S.prototyp eandS -IND EL-va riant PEDVstra ins (Wangetal., swab, fece s, sm all int estin e, and or al flu id) usin g tacoTM mini 201 4c). However,i mple mentationofthe serRT -PCRas saysreq ui res Nucle icAcid Autom aticExtrac tionS ystem (taco TMmin i,GeneReach trained technician sandsophistica te dand expensi veinst ruments USA).Br iefly ,200(cid:2)lof thesample swere addedintoth efirstwell and the refore these rRT -PCR assays a re n ot suitable for on-site ofata coTMPr eloa ded D NA/ RNAExt ractio nplate (Gen eRe achU SA) applications.Inrecentyears,apoint-of-needPCRdetectionplat- andsubjectedtotheextractionstepsasdescribedinthemanufac- formintegrat in gthein sulate d isothermalPCR (iiP CR)techn ology ture r’suserma nu al.N ucleicacid swer ee lutedinto 20 0(cid:2)l ofElution and a field-deplo yab le device (POCKITTM Nuc leic Aci d Analyzer) buffer. hasbeendevelopedandisnowcommerciallyavailableforauto- maticdetectionandinterpretationofPCRresultswithinonehour 2.4. Invitrotranscribed(IVT)RNA (Tsaietal.,2014,2012b).TheiiPCRorRT-iiPCRassayshavebeen demonstratedtohaveexcellentsensitivityandspecificityforthe TopreparethePEDVandPDCoVRNAstandards,plasmidsartifi- detectionofvarioustargets,includingclassicalswinefevervirusin ciallysynthesizedtocontainafragmentofthemembrane(M)gene 36 J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 ofPEDVUSA/IN19338/2013strain(nucleotides[nt]25978–26066; designed to target two different highly conserved regions in the GenBank accession no. KF650371) (Chen et al., 2014) or a frag- MgeneamongPEDVstrainsfromallknowncladesandamongall mentoftheMgeneofPDCoVUSA/IA/2014/8734(nt23356–23461; known PDCoV strains, respectively(Table 1). An internal control GenBankaccessionno.KJ567050)(Lietal.,2014)werelinearized (IC)containinganartificialnucleotidesequencewasalsoincluded andsubjectedtoinvitrotranscription(IVT)usingtheMEGAscript in this multiplex rRT-PCR. The expected size of the IC amplicon T7Kit(ThermoFisherScientific).RNAtranscriptswereproduced, was100bp.ThePEDV,PDCoV,andICampliconswereindividually treatedwithDNaseI,andpurifiedbyLiClprecipitationfollowing detectedbyaFAM-,NED-,andCy5-labeledTaqManprobe,respec- theman ufact urer’si n struc tions.Co py num bersofRNAt ranscripts tively.Th er RT -PCRa mplifi cati onwascarrie doutin 25(cid:2)lr eaction wer ecalculatedba sedonconce ntrati onsdeter mi ned byaNano- mixtur esc ontaining 20(cid:2)lofmast erm ixture, 2.5(cid:2) lo f2 00 nMROX Drop 2000 spec tropho tom eter (Thermo Fisher Scien tific ). Serial and2.5(cid:2) loftheext rac ted n ucleica cids.The dup le xP EDV /PD CoV diluti onsof RNAwereprepared in40ng /(cid:2)lyea sttRNA.Al iquots rRT- PCR w as per formedon anABI 7500 Fast instrum ent(Thermo werefroz en at−8 0◦Cf orsingleu se of eacha liquot . FisherSc ienti fic).Thecon dit ion swe reset asfo llows:30mi nat42◦C and15 minat93 ◦C,f ollowedby 45cy cle so fdenatu rat ion at 93◦C 2.5. PEDVandPDCoVreferencereal-timeRT-PCRs for1 5s and an nealin g-elonga tio na t60◦C fo r1min.Fluor esc ence sign als were capturedatthe60◦C s tep.T he th resho ldfortheCt AsingleplexPEDVnucleocapsid(N)gene-basedrRT-PCR(Lowe analysis was manually adjusted to 0.05, together with an auto- etal.,2014;Madsonetal.,2014;Thomasetal.,2015)andasingle- maticbaseline.TheCtoftheinternalcontrolwasdesignedtobe plexPDCoVMgene-basedrRT-PCR(Chenetal.,2015)previously about 30 under these conditions. In addition to clinical samples, developedandroutinelyusedattheISUVDLfordiagnostictesting theserialdilutionsofPEDVIVTRNA,PDCoVIVTRNA,PEDVisolates wereincludedinthisstudyasthereferencePCRsforthedetectionof and PDCoV isolates were also tested by the duplex PEDV/PDCoV PEDV andPDCo V .Eac hPCR w asse tupina2 0(cid:2)lt ota lre actionusin g rRT- PCR. Th e linear corre latio n coeffi cie nt ( R2) and slope of the TaqM an® Fast1-S tepM aste rMi x(T he rm o Fis he rScie ntific):5 (cid:2)lof curvewe rede termin edautomati callywitht he75 00R eal-Tim e PCR 4×MasterMix ,0.4(cid:2)l offorw ard primerat 20(cid:2)M ,0.4(cid:2)lofr ev er se System sof tware. The slope was use d to calc ulate amplifica tion prim er at 20(cid:2)M , 0 .2 4(cid:2) l of pro be at 1 0(cid:2) M , 1(cid:2) l XE NO I nternal efficien cies (E=10 1/−sl ope−1 ) for each pr imer/pair set. Based on Control Re age nt ( Therm o Fi sher Sc ien tifi c), 7 .96 (cid:2) l nucle ase-free statisticala nal ys isofanalyt ica lse nsitiv itywithIVT RNA ofkno wn water,a nd5(cid:2)ln ucleicac idextr act.Amplifi catio nr eactionswere copies,cut offCtoft he duplexPE DV/PDCoV rRT-P CRf orPE DV (FAM) performedonanABI7500Fastinstrument(ThermoFisherScien- and PDCoV (NED) detection was both set at 40 to achieve >50% tific) with the fo llow ing co ndit ions: 1 cycl e of 50◦C for 5 min, 1 dete ctionat 10cop iesperrea ction (Car agu ele ta l.,2 011). cycle of95 ◦C for20s,an d40cycles of 95◦C fo r3sa nd 60 ◦Cfo r 30s.Anycyclethreshold(Ct)values<40werereportedaspositive. 2.8. Statisticalanalyses 2.6. PEDVRT-iiPCRandPDCoVRT-iiPCR For limit of detection 95% (LoD95%) calculation, probit regres- sionanalysiswasperformedtocalculatetheconcentrationofthe The RT-iiPCR methods for PEDV (POCKITTM PEDV Reagent templatethatcouldbemeasuredwith95%probabilityusingSPSS Set,Ge neReach,U SA)and PDC oV(PO CKITTM PDCoVRea gentSet, Statistics 14.0 (SPSS Inc .,Chicago,I L).Ka ppa’ stestswere perfor med GeneReach,USA)weredesignedaccordingtothehydrolysisprobe- todeterminetheagreementbetweendifferentRT-PCRassaysand basedPOCK ITTM metho ddescrib edprevio us ly(T saietal.,2 012b). be tweendiffe ren textraction methods . AsshowninTable1,theprimersandprobeforPEDVweredesigned totargetahighlyconservedregioninMgeneamongPEDVstrains; 3. Results thePDCoVRT-iiPCRprimersandprobealsotargetedahighlycon- served region in M gene among PDCoV strains. Both PEDV and 3.1. AnalyticalspecificityofPEDVRT-iiPCR,PDCoVRT-iiPCR,and PDCoVRT-iiPCRprobeswerelabeledwithFAMfluorescentreporter duplexPEDV/PDCoVrRT-PCRassays dyeatt he5(cid:4)end .ThePE DVp robewa slab eledw ithaninte rnalZEN que nc her andIow aB lackFQ (IWB kFQ )quench erat th e3(cid:4)end. The AsshowninTable2,thePEDVRT-iiPCRandduplexPEDV/PDCoV PDCoVprobewaslabeledwithaminorgroovebindergroup(MGB) rRT-PCR (reporter dye for PEDV detection) as well as the refer- witha non-flu ore scentqu ench e r(NFQ )atthe 3(cid:4)end. After adding ence PED V rRT-PC R on ly s pecific ally reacte d w ith P ED V an d did 5(cid:2)l of thenucleicacid sample,t hefin al Prem ix/sam plem ixture not c ross-r eact with oth er enteric p athogen s inc luding PDC oV, w as tra nsfe rred to an R -tubeTM (Ge neRe ach USA). The t ube was TGE VPurduest rain,T GEVM illerstr ain,PHEV,p orcinerot aviruses spun briefly in a C ube eTM mini centrifuge (G eneRe ach USA) and (Grou psA,Ba ndC),P RCV,E coli,S. typhim urium, C.difficil e,C.perfrin- place dintot he r eactionchambe rofPOCKI TTM Nucleic AcidA na- gens,B.h y od ysen ter iae,an d L.i nt racellularis.Si m ilarly,th e PDCoV lyzer.T hed efau ltprogra moftheP O CKITTMdeviceinclu desa nRT RT-iiP C RandduplexPED V/P DC oVrRT-PCR(re porterdye for PDCoV stepa t50 ◦Cfor10 minand an iiP CRstepat95◦Cfo rabout3 0m in. detection ) as well a s the referen ce PDCoV rRT-PCR on ly s pecifi- The rea ction co mp lete d in les s tha n on e h our. POC KITTM de vice callyreacte dw ithP DC oVa nddidnot cross-r eactwith other enteric collectsopticalsignalsthroughanintegratedcircuitscontrolled- pathogens(Table2). regulated sensor. Signal-to-noise (S/N) ratios were calculated by dividing light signals collected after iiPCR by those from before 3.2. AnalyticalsensitivityofPEDVRT-iiPCRandduplex iiPCR(Tsaietal.,2012b).Basedonthedefaultthresholds,S/Nratios PEDV/PDCoVrRT-PCRassaysforPEDVdetection of<1. 2and > 1.3 wereas signed as “+” and“− ”,respectiv ely. A“?” resultwasassignedtothosewithanS/Nratiobetween1.2and1.3, The analytical sensitivities of the PEDV RT-iiPCR and duplex indicatingthatthesignalswereambiguousandthesampleshould PEDV/PDCoV rRT-PCR (FAM-labeled TaqMan probe) for PEDV betestedagain. detectionweredeterminedbytesting10-foldserialdilutionsofan IVTRNAcontainingpartialPEDVMgenesequence.ForthePEDV 2.7. DuplexPEDV/PDCoVreal-timeRT-PCR RT-iiPCR,testingvariousreplicatesof100,50,20,5and0copies of standard RNA per reaction revealed that 10/10 (100%), 20/20 PrimersandprobesoftheduplexrRT-PCRforPEDVandPDCoV (100%),18/20(90%),9/20(45%),and0/24(0%)producedpositive (IQREALPEDV/PDCoVQuantitativeSystem,GeneReachUSA)were resultsontheseRNAcopies,respectively.TheLoD ofthePEDV 95% J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 37 Table1 PrimersandprobesofvariousPEDVandPDCoVRT-PCRsevaluatedinthisstudy. Assayname Primer&Probe Nucleotidesequence(5(cid:4)–3(cid:4))a NucleotidePosition Targetgene Amplicon Reference PEDV PEDViiF AATAGCATTCGGTTGTGGCG 25978–25997 M 89bp This RT- PEDViiR CGGCCCATCACAGAAGTAGT 26066–26047 paper iiPCR PEDViiP FAM-CATTCTTGG/ZEN/TGGTCTTTCAATCCTGA-IABkFQ 26005–26030 PDCoV PDCoViiF GAGAGTAGACTCCTTGCAGGGATTAT 23356–23381 M 106bp This RT- PDCoViiR GCTTGCCATGCTTAACGACTG 23461–23441 paper iiPCR PDCoViiP FAM-AATGCACCTCCATGTACC-MGB 23409–23392 PEDV/PDCoVduplex PEDVrF GGTTGTGGCGCAGGACA 25988–26004 M 79bp This real-timeRT- PCRa PEDV rR CGGCCCATCACAGAAGTA GT 26066–26047 paper PEDVrP FAM-CATTCTTGG/ZEN/TGGTCTTTCAATCCTGA-IABkFQ 26005–26030 PDCoVrF TGAGAGTAGACTCCTTGCAGGGA 23355–23377 M 105bp PDCoVrR GAGAATTGGAGCCATGTGGT 23436–23417 PDCoVrP NED-TGTACCCATTGGATCCATAA-MGB 23397–23378 PEDVreal-timeRT-PCR PEDV-F CGCAAAGACTGAACCCACTAACCT 26684–26707 N 198bp Loweetal. PEDV-R TTGCCTCTGTTGTTACTTGGAGAT 26881–26858 (2014) PEDV-P FAM-TGTTGCCAT/ZEN/TACCACGACTCCTGC-IABkFQ 26847–26824 PDCoVreal-time PDCoV-F CGACCACATGGCTCCAATTC 23415–23434 M 70bp Chen RT-PCR PDCoV-R CAGCTCTTGCCCATGTAGCTT 23484–23464 etal. PDCoV-P FAM-CACACCAGT/ZEN/CGTTAAGCATGGCAAGC-IABkFQ 23436–23461 (2015) a NucleotidepositionsofPEDVandPDCoVprimersandprobesarebasedonGenBankaccessionno.KF650371andKJ567050,respectively. RT-iiPCR was estimated to be 21 RNA copies/reaction by probit 10−7dilutionfortheU.S.PEDVprototypeisolateand10−6dilution regressionanalysis.FortheduplexPEDV/PDCoVrRT-PCR,eachdilu- forPEDVS-INDEL-variantisolate(Table3),indicatingthatthePEDV tionofthe PEDVIVT RN A(1 06,105 ,104,103,102 ,50,20,1 0,5a nd0 RT- iiPCR andduplexPEDV /PDCoV rRT-P CR wereabou t10 –10 0fold copies)wasrunintwotoeightreplicates.Thestandardcurvehadan lesssensitivethanthereferencesingleplexPEDVrRT-PCRindetect- r2=0.99 and as lop eof − 3.18i ntherange of1 06to10 copies oft he ingP EDVRNA . PEDVIVTRNA.TheLoD oftheduplexPEDV/PDCoVrRT-PCRfor 95% PEDVdetectionwascalculatedtobeabout7RNAcopies/reaction 3.3. AnalyticalsensitivityofPDCoVRT-iiPCRandduplex bypro bitanalys is. PED V/PDCoVrR T-PCRassa ys forPDC oVdetec tion The an alytical sensitivities of the PEDV RT-iiPCR and duplex PEDV/PDCoVrRT-PCRassaysforPEDVdetectionwerealsoevalu- TheanalyticalsensitivitiesofthePDCoVRT-iiPCRandduplex atedbytestin gRNAex tractsfr om 10-fo ldserialdi lution s(tri plicate PEDV/P DCoV rRT -PCR (NED-l abe led TaqMa n probe) for PDCoV fore ach dilutio n)of PEDVce llcult ureisol ates(U .S.PEDV prototype detectionwer edeterm inedfirstbytes ting10-fo ldserial dilu tionsof iso late a nd S-IND EL -varia nt i solate) and com pare d to that of an anIVTRN Acon tainingtheta rget PD CoVM genese quenc e.Thetes t- Ngene -bas edsingleplexPED VrRT-P CRre ferenceas say .The 10 0% ing res ultso fthePDCo VRT -iiPCR were1 0/ 10(1 00%),24/2 4(10 0%), de tectionendp ointsofth ePEDV RT-iiPC Randdup lexPED V/P DCoV 46/ 46(100 %) ,13 /16(81 %),41/46 (89% )and 0/29(0% )posi tiveon rRT-PCRt odetectU. SP EDV prot otypeiso late andS-IN DEL-variant reactio nscont aining 100,50 ,20,1 0,5an d0P DCoV IVT RNAcop ies isolatew er eboth at1 0−5di lutions(Ta ble3). Inco ntrast,the100% perreacti on,respect ively .Th eL oD oft h ePDCo VRT -iiPC Rwas detecti onen dpoin ts ofthereference single ple xP EDVrRT- PCR were abo ut9RNA copies/reactio nby pro9b5i%tre gres sionan alysis.For the Table2 SpecificityofvariousPEDVandPDCoVRT-PCRsevaluatedinthisstudy.(Forinterpretationofthereferencestocolorinthistablelegend,thereaderisreferredtotheweb versionofthisarticle.) *PorcinerotavirusesincludegroupsA–Cporcinerotaviruses. ¯lS/N:Sig nal-to-noise ratio. (cid:2) IC:InternalControl. Nuc leicacids wereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific. 38 J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 Table3 AnalyticalsensitivityofPEDVRT-iiPCRandduplexPEDV/PDCoVreal-timeRT-PCRfordetectionofPEDVRNAandcomparisonwiththereferencesingleplexPEDVreal-time RT-PCRusingviralRNAfromtheseriallydilutedPEDVcellcultureisolates.(Forinterpretationofthereferencestocolorinthistablelegend,thereaderisreferredtotheweb versionofthisarticle.) Note:NucleicacidswereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific. duplexPEDV/PDCoVrRT-PCR,eachdilutionofthePDCoVIVTRNA assaysinaside-by-sidecomparisonstudytestingapanelof170 (106,10 5,104,103,10 2,50,20, 10,5 and0co pie s)w asrun intw oto archive d cli nicalspecime ns,includin g86fe calswa bs ,24fe ces ,19 eight repl icate s.Th esta nda rd curv e had a nr2=0 .99a nda sl ope of intestine s,and4 1oralfluid samples.D is tribut ionsof 17 0clini cal −3.13 intherang eof 106to20 copies ofth eP DCo VIVT RNA . Accor d- samplesba sed on spec imen typesan dCtrangesar es umm arized ingly,probitanalysisindicatedthatLoD oftheduplexrRT-PCR inTable5.Among170samples,88sampleswerepositivebythe 95% forPDCoVwasabout14copiesperreaction. referencePEDVrRT-PCRwithCtrangesof12.2-35.7;82samples Analytical sensitivities of the PDCoV RT-iiPCR and duplex werepositivebythereferencePDCoVrRT-PCRwithCtrangesof PEDV/PDCoV rRT-PCR were also determined by testing RNA 15–37.1;16sampleswerepositiveforbothPEDVandPDCoV. extractsfrom10-foldserialdilutions(triplicateforeachdilution)of Comparisons of the PEDV RT-iiPCR and the reference PEDV PDCoVcellcultureisolateandcomparedtothatofanMgene-based rRT-PCRontesting170clinicalsamplesforPEDVdetectionaresum- singlep lex PDCoVr RT-PCR ref erenceass ay .The 10 0% e ndpointsto marized in Table6 a.Ka ppaan alysisof the 2×2 contingen cy table detectPDC oVwer eat10− 5 dilution forbot hPD CoV RT-iiPCRa nd showed tha tthe sen sitivity oftheP ED VR T -ii PC Rwas97.73 %(CI singlep lexrefe rence P DCoVrRT-PCR ,an dat 10−4 di lutionfor the 95%:93. 50–1 00% )andspecifi ci tyw as98.7 8%(CI95 %:94 .86–10 0%) duplexPEDV/PDCoVrRT-PCR(Table4),indicatingthattheduplex whencomparedtothereferencePEDVrRT-PCR.Overallagreement PEDV/PDCoV rRT-PCR was 10-fold less sensitive than the PDCoV betweenthereferencePEDVrRT-PCRandthePEDVRT-iiPCRwas RT-iiPCRandreferencePDCoVrRT-PCRforPDCoVRNAdetection. 98.24%(CI95%:95.74–100%)withakappavalueof0.96.Asshownin Table6b,whencomparedtothereferencePEDVrRT-PCR,thesensi- tivity,specificityandaccuracyoftheduplexPEDV/PDCoVrRT-PCR 3.4. PerformancesofPEDVRT-iiPCR,PDCoVRT-iiPCRandduplex forPEDVdetectionwas98.86%(CI95%:95.20–100%),96.34%(CI PEDV/PDCoVrRT-PCRindetectingPEDVandPDCoVinclinical 95%:91.31–100%),and97.65%(CI95%:94.92–100%;kappa=0.95), samples respectively. As shown in Table 6c, 100% agreement (CI 95%: 98.90–100%; ToevaluatetheperformancesofthePEDVRT-iiPCR,PDCoVRT- kappa=1) was found between the PDCoV RT-iiPCR and the ref- iiPCRandduplexPEDV/PDCoVrRT-PCRassaysindetectingPEDV erence PDCoV rRT-PCR with the sensitivity of 100% (CI 95%: and PDCoV in clinical samples, previously published singleplex 96.80–100%)andspecificityof100%(CI95%:97.01–100%)forthe PEDV rRT-PCR and PDCoV rRT-PCR were used as the reference Table4 AnalyticalsensitivityofPDCoVRT-iiPCRandduplexPEDV/PDCoVreal-timeRT-PCRfordetectionofPDCoVRNAandcomparisonwiththereferencesingleplexPDCoVreal-time RT-PCRusingviralRNAfromtheseriallydilutedPDCoVcellcultureisolate.(Forinterpretationofthereferencestocolorinthistablelegend,thereaderisreferredtotheweb versionofthisarticle.) Note:NucleicacidswereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific. J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 39 Table5 Specimentypesof170clinicalsamplesandCtrangesofpositivesamplestestedbythereferencePEDVrRT-PCRandPDCoVrRT-PCR. Specimentype Number Positivebythereference Positivebythereference Positivebyboththereference PEDVrRT-PCR PDCoVrRT-PCR PEDVandPDCoVrRT-PCRs Number Ctranges Number Ctranges Number Fecalswab 86 47 14.1–30.6 37 16.7–35.6 5 Feces 24 9 12.2–30.8 17 15.0–28.3 2 Intestine 19 10 16.2–34.1 9 17.2–31.7 0 Oralfluid 41 22 14.6–35.7 19 20.3–37.1 9 Note:NucleicacidswereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific. PDCoVRT-iiPCRwhencomparedtothereferencePDCoVrRT-PCR. Five of the 88 positive samples identified by the MagMAXTM Thesensitivity,specificityandaccuracyoftheduplexPEDV/PDCoV extraction/reference PEDV rRT-PCR system (#43Ct=34.1; for PDCoV detection was 96.34% (CI 95%: 91.31–100%), 100% (CI #45Ct=32.6; #63Ct=30.8; #75Ct=35.1; and #146Ct=35.7) 95% :97.01 –100%),an d98 .24%(CI 95% :95.7 4–100%;kapp a=0.9 6), were n egativ e by th e taco TM min i extra ction /PEDV RT - iiPCR respe ctively, when co mpared to the reference PD CoV r RT -PCR syste m(Table8 a).A ll82 samplesnega tivebyMagMAXT Mextrac- (Table6d). tion/reference PEDV rRT-PCR system were also negative by the Dis crepantresultswereobservedonthreesamplesbetweenthe tacoTM mini e xtracti on/PEDV RT-iiPC R syst em. Total agr eem ent PEDV RT-iiPCR and the reference PEDV rRT-PCR (Table 6a), four between the two systems was 97.06% (CI 95%: 94.12–100%; samples between the duplex PEDV/PDCoV rRT-PCR and the ref- kappa=0.94). erenceP EDVrRT- PCR (Table6 b),andthree samples betw een the Wh e nthe170samplesweretestedforPDCoV,theMagMAXTM duplex PEDV /PDCoV r RT-PCR an d the refer ence PD CoV rRT- PCR extraction /re feren cePDCo VrRT -PCRs yste mand the tacoTM mini (Table6d).ThesediscrepanciesaresummarizedinTable7. extraction/PDCoV RT-iiPCR systems yielded the same results (Table8b)with100%agreement(CI95%:98.43–100%;kappa=1) betweenthetwosystems. 3.5. PerformancecomparisonsbetweentacoTMmini extr action/POCKIT TMPCRsyste mandMa gMAXTM extraction/real-timePCRsystemindetectingPEDVandPDCoVin clinicalsamples 4. Discussion Toevaluatetheperformanceoftheportablesystemcombining Compared to the epidemic phase (April 2013–April 2014) of theta coTMmin iex tractionand PO CKIT TMampl ification /detection PEDV in the U.S ., th e incidenc e of PE DV ha s now subs ided, b ut method for PEDV and PDCoV detection in clinical samples, the there are still 34 U.S. states positive for PEDV, 14 states positive tacoTMm ini extrac tion/ PEDVRT -iiPCRsys tem wasco mparedto the forPD CoV ,and 14 stat eswith premise sp ositive for bothP EDVand MagMAXTM extraction/refere ncesingl eplexP EDV rRT-PCRsy st em PDC oV,acc ordi ng tothe USDA reporto nOctobe r2 2,20 15(ww w. (Table8a)andthetacoTMminiex traction/PD CoV RT-iiPCR system aasv.org ). PEDV a nd PDC oV ha ve also em erged o r re -eme rged in wasco mp ared to theMagMAX TM extraction/refe rencesin gleplex othercou ntries. Rapi ddiagn osisi scrit icalforth eim plementati on PDCoV rRT-PCR system (Table 8b), based on testing 170 clinical ofefficientcontrolstrategiesbeforeandduringPEDVandPDCoV samples. outbreaks. Table6 SensitivityandspecificityofPEDVRT-iiPCR,PDCoVRT-iiPCR,andduplexPEDV/PDCoVrRT-PCRascomparedtothereferencesingleplexPEDVrRT-PCRandPDCoVrRT-PCR basedontesting170clinicalsamples. ReferencePEDVrRT-PCRorreferencePDCoVrRT-PCR Positive Negative Total (a)PEDVRT-iiPCRcomparedtothereferencesingleplexPEDVrRT-PCR PEDVRT-iiPCR Positive 86 1 87 Negative 2 81 83 Total 88 82 170 Sensitivity:97.73%;Specificity:98.78%;Accuracy:98.24% (b)DuplexPEDV/PDCoVrRT-PCRcomparedtothereferencesingleplexPEDVrRT-PCR DuplexPEDV/PDCoVrRT-PCR Positive 87 3 90 Negative 1 79 80 Total 88 82 170 Sensitivity:98.86%;Specificity:96.34%;Accuracy:97.65% (c)PDCoVRT-iiPCRcomparedtothereferencesingleplexPDCoVrRT-PCR PDCoVRT-iiPCR Positive 82 0 82 Negative 0 88 88 Total 82 88 170 Sensitivity:100%;Specificity:100%;Accuracy:100% (d)DuplexPEDV/PDCoVrRT-PCRcomparedtothereferencesingleplexPDCoVrRT-PCR DuplexPEDV/PDCoVrRT-PCR Positive 79 0 79 Negative 3 88 91 Total 82 88 170 Sensitivity:96.34%;Specificity:100%;Accuracy:98.24% Notes:(1)NucleicacidswereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific.(2)The referen ce PEDVrR T-PCR and PDCoVrRT -PCR :C t<40pos itive. (3)T heduplexPE DV/PDCoV rRT-PCR: Ct <40 positive;Ct≥4 0negative. 40 J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 Table7 DiscrepanciesonclinicalsamplesbyvariousPEDVandPDCoVRT-PCRs.(Forinterpretationofthereferencestocolorinthistablelegend,thereaderisreferredtotheweb versionofthisarticle.) Note:(1)NucleicacidswereextractedfromallsamplesusingtheMagMAXTMPathogenRNA/DNAKitandKingfisher-96instrumentfromThermoFisherScientific.(2)Samples withdiscrepancyresultsbyPEDVRT-iiPCRandthereferencePEDVrRT-PCRorbyduplexPEDV/PDCoVrRT-PCRandthereferencePEDVrRT-PCRarehighlightedinlightblue color.(3)SampleswithdiscrepancyresultsbyduplexPEDV/PDCoVrRT-PCRandthereferencePDCoVrRT-PCRarehighlightedinlightbrowncolor. RecenttechnologyoftheiiPCRontheportablePOCKITTMdevice cultureisolate,thePDCoVRT-iiPCRhadequalsensitivityforend- providesasimple,convenientandinexpensivemethodforon-site pointdetectiontothereferencePDCoVrRT-PCR(Chenetal.,2015). detectionofpathogensinclinicalsamples(Tsaietal.,2012b).For Overall,thePEDVRT-iiPCRandPDCoVRT-iiPCRhadanalyticalsen- example,iiPCRmethodshavebeenusedinsmallanimalclinicsand sitivities comparable to the reference PEDV rRT-PCR and PDCoV shelters (e.g. canine distemper virus and canine influenza virus), rRT-PCR. onlivestockfarms(e.g.porcinecircovirustype2),onshrimpfarms Forevaluationofperformancesonclinicalsamples,nucleicacids (e.g .whitesp otsyn dro mevirus andEnter ocyto zoo nh epatope naei), werefi rstextracte df rom170clinic als amples usingthe MagMA XTM andbygovernmentagencies(e.g.classicalswinefevervirusand Pathogen RNA/DNA Kit and Kingfisher-96 instrument and then Vibrioparahaemolyticus-acutehepatopancreaticnecrosisdisease) tested by the PEDV RT-iiPCR, PDCoV RT-iiPCR, and the reference forsurveillanceanddiagnosticpurposesinvariouscountries(Lung PEDVrRT-PCRandPDCoVrRT-PCR.ComparingvariousPCRsusing etal.,2015;Tsaietal.,2014;Wilkesetal.,2014b).Inthecurrent thesamenucleicacidextractseliminatesvariationsonnucleicacid study,wedevelopedandevaluatedPEDVRT-iiPCRandPDCoVRT- extractionsandtrulyreflectstheperformancedifferencesoneach iiPCRassayswhichwerehighlyspecificanddidnotcrossreactwith PCRitself.Therewerediscrepantresultsonthreesamplesbetween otherentericpathogens.ThePEDVRT-iiPCRandPDCoVRT-iiPCR thePEDVRT-iiPCRandthereferencePEDVrRT-PCR(Tables6aand hadhighanalyticalsensitivitywithLoD of21copiesofPEDVRNA 7) and zero discrepant results between the PDCoV RT-iiPCR and 95% moleculesperreactionand9copiesofPDCoVRNAmoleculesper the reference PDCoV rRT-PCR (Tables 6 c and 7), demonstrating reaction,respectively.AnalysisofviralRNAextractedfrom10-fold excellentagreementsbetweenthesePCRassays. serial dilutions of PEDV cell culture isolates (a U.S. PEDV proto- However,itisimpossibletoextractnucleicacidsfromsamples types trainand aU .S.PED VIN DEL-va riantstr ain )sho wedt hatthe using the M ag M AXTM Path og en RNA /DNA K it an d Kin gfisher- PEDV RT-ii PCR w as1 0–100 foldlesssensi tivefor endpoin tdet ec- 96 in strum ent in field situations . A portabl e PO CKIT TM package tionc ompared toth erefere nce PEDV rRT-PCR (Lo weetal., 2014; inc ludes reage nts and CubeeTM m in i centrifu ge for tacoTM mini Mad sonetal.,2 01 4;Th omaseta l.,2015 ).Howev er,itis no tew orthy nucleica cidextrac tion, lyophilizediiPC Rreagents ,and aPOCKITTM thatthereferencePEDVrRT-PCRwasrun40cyclesinthisstudyand Nucleic Acid Analyzer. This ensures nucleic acid extraction and allCtvalues<40werereportedaspositivewithoutanestablished iiPCR testing can be completed within 1.5h in field. Since under cut off Ct. Th e en dpoin t dilution s negative by the PED V RT-iiPCR field conditi ons, tac oTM mini extract ion a nd iiPC R are com- butpositivebythereferencePEDVrRT-PCRhadveryhighCtvalues binedfortesting,wefurthercomparedtheclinicalperformances (35. 4–37.5). W hen testing10 -fold serialdi lutio nso faPD Co Vcell of the ta coTM m ini extracti on/RT-iiPC R sy stem t o MagMAXTM Table8 SensitivityandspecificityofPEDVRT-iiPCRandPDCoVRT-iiPCRascomparedtothereferencesingleplexPEDVrRT-PCRandPDCoVrRT-PCRbasedontesting170clinical sampleswithdifferentnucleicacidextractionmethods. (a)ComparisonofPEDVRT-iiPCRandthereferencesingleplexPEDVrRT-PCR MagMAXTMextractionandreferencePEDVrRT-PCR Positive Negative Total tacoTMminiextractionandPEDVRT-iiPCR Positive 83 0 83 Negative 5 82 87 Total 88 82 170 Sensitivity:94.32%;Specificity:100%;Accuracy:97.06% (b)ComparisonofPDCoVRT-iiPCRandthereferencesingleplexPDCoVrRT-PCR MagMAXTMextractionandreferencePDCoVrRT-PCR Positive Negative Total tacoTMminiextractionandPDCoV Positive 82 0 82 RT-iiPCR Negative 0 8 8 88 Total 82 88 170 Sensitivity:100%;Specificity:100%;Accuracy:100% J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 41 extraction/referencerRT-PCRsystembasedontesting170clinical Chen,Q.,Gauger,P.C.,Stafne,M.R.,Thomas,J.T.,Madson,D.M.,Huang,H.,Zheng,Y., samples.Overall,97.0 6%agree mentw asobs erv edforth etw oPEDV Li ,G. ,Zhang, J.,20 16a.Pa thoge nesiscom par isonbetw een theUnit ed States po rcin eepide m icdiarr heaviruspro totypeandS -INDEL-v aria ntstrai nsin P(TCaRb lseys8t)e.ms and 100% agreement for the two PDCoV PCR systems c0o0n0v4e1n9t i[oEnpaulb naehoen aadtaolf ppigril nett]s.. J. Gen. Virol. , htt p://dx.doi.org/10 .1099/jg v.0. Due to prevalence and co-circulation of PEDV and PDCoV in Chen,Q.,Th omas, J.T.,Gim é nez-Lirola,L.G.,Hardham,J.M.,Gao,Q.,Gerber,P.F., Op rie ssnig,T., Zhe ng,Y.,Li,G.,Gau ger,P .C.,Madso n,D. M.,M ag stadt,D. ,Zhang, some areas, there are advantages of detecting and differentiating J.,2016b.Ev alu ationo fs ero log icalcros s-rea ctivityan dcro ss-neutral iza tion PEDV and PDCoV in a single sample using a multiplex rRT-PCR. be tween theUnited Sta tesporcine epidemicdiarrh eav irusprototypeand Inthe pres entstu dy, a duplex PEDV/P DCoV rR T-PCRinc ludingan S-INDEL- vari antstra ins.BM CVet.R es.12(1) ,70,http ://dx.d oi.org/10. 1186/ int ern alcontro lwas ev aluated .Theduplex PEDV/PD CoVrRT-P CR s12917-016-069 7-5. Grasland,B.,Bigault,L.,Bernard,C.,Quenault,H.,Toulouse,O.,Fablet,C.,Rose,N., wasalsohighlyspecificandsensitivewithLoD95%of7copiesper Touza in, F.,Blanc ha rd,Y.,20 15. Complete gen omesequ enc eofap or cine reac tion forPED Vand1 4co piesperr eactio nforPDC oV .Based on epidemic di arrheasge ne indels trainisola tedinfr anceinde ce m ber2014. testing 1 70 clinica l sa mp les, the du plex rRT- PCR showe d 97.6 5% HuaGnge,nYo.mWe., A Dnicnkoeurnmca. 3n ,(A3.)W, e .0,0P5in3e 5y-r1o5,.P .,Li,L.,Fa ng ,L.,Kie hn e,R.,Opri essnig,T., agreement for PEDV detection compared to the reference PEDV Me ng,X.J .,2013.Orig in,ev olution,a nd ge no typin go femerge nt porcine rRT-PCRan d98 .24%a greement forPDCoV de tect ioncompa redto epidem icd iarrhe avirus strainsint heU nitedStates .M Bio4(5), e00737-13. therefer ence PDCoV rRT-PCR.S ixte ensam plesthatw erepositi ve Jung,K.,Wan g,Q.,Sche uer,K .A.,Lu, Z. ,Zha ng,Y., Saif,L.J .,2014 . Path ologyofUS p orc ineepi dem icdiarrh eav irus str ainPC2 1A ing noto biotic pigs.Eme rg. froRrT -bPoCtRh aPnEdDVPD aCnodV PrDRCT-oPVC Rasw deerteersmucicneesds fbuyll ythide ernetfiefireedncaen dPEdDisV- JungI,nKfe.,cHt.u D, iHs.. ,2E0y, e6r6ly2 ,–B6.6,L5u.,Z .,Che pngen o,J.,Sai f,L .J.,2015.Pa thoge nicityof2 tinguishe dby thedu plexPED V/PD CoVrRT-PCR . p orc ine del tacoron avi rus str ainsingnoto b iotic pigs .Eme rg.Infect.Dis.2 1, 650–654 . Inthisstudy,170clinicalsamplesincludingfecalswabs,feces, intest ines ,ando ralfl uidswe reusedt oevaluate vario usPED Vand Kimr, eSa.Hl-.t, iKmimeR, IT.J-.P, CPyRof,o Hr.tMhe., sTiamrku,l Dta.nS.e, oSuosngd,e Jt.eYc.,t iHoynuann, dB.qHu.,a 2n0ti0fi7c.a Mtiounltiopflex PDCoVPCR s.O ccas ionally ,ther eisa n eedtote stother specim en transmiss iblegas troe nte ritisvirusand porcineep idem icdiarrheavi rus.J. Virol.Method s146,172–177 . types such as feed and environmental samples for presence of PEDV Lee,S.,Le e,C.,2014 .Com pletegenomecharacterizationofkoreanporcine and/or PDCoV. In fact, the reference PEDV rRT-PCR (Lowe et al., del taco ron avirus strainKO R/KNU14 -04/2014.Genom e Annou nc.2. 2014;M adsone ta l.,20 14)a ndtheref erence PDCoVrR T-PCR (Ch en Li,W.,Li,H.,Liu,Y.,Pa n,Y., Deng,F.,Song,Y.,Tang ,X.,He,Q .,2012.Ne wvariantsof et al., 2 015) ha ve bee n succ essf ully used to de tect PE DV and P DCoV p13o 5rc0i –n1e3 e5p3id. em ic di arr hea vir us , Chin a, 2 011. E me rg. Infe ct. Dis . 18, RNAfromfeedandenvironmentalsamplesattheISUVDL.Although Li,G.,Chen,Q.,Harmon,K.M.,Yoon,K.J.,Schwartz,K.J.,Hoogland,M.J.,Gauger,P.C., note valua tedi nth ecurrentstudy ,itisexp ec ted tha tthe PEDVRT- M ain,R. G., Zhang,J., 2014 .Full-l engt hgenome sequ enceofpo rcine iiPC R, PDCoV R T- iiPC R, and d uplex PE D V/PDCoV r RT-P CR should be Lowdee,lJt.,aGc oaruogne arv,Pir.u,Hs as trrm aionn U,KS .A,/ZIhAa/2n0g1,J4.,/8C 7o3n4n.o Gr,eJn .,oYmesek Aen,Pn. o,uL onucl. a2,.T.,Levis,I., abletodetectPEDVand/orPDCoVRNApresentinfeedandenviron- Du fr esne,L., Ma in,R.,201 4. Roleof tr ansporta tio ninsp re adofp orc ine men tal sampl esasw ell.St udiesto vali datethe o n-sit eap plication epidemic dia rrhea vir usinfe ction ,U nitedStates.E me rg.Infe ct. Dis.20, oftheR T-iiPCR/ PO CKITT Msystem t ohelpm oni torthe presenceof 872–874. Lung,O.,Pasick,J.,Fisher,M.,Buchanan,C.,Erickson,A.,Ambagala,A.,2015. PEDInV sinu mthme aernyv,irtohnemPeEnDtV isR cTu-ririPeCnRtl,y PuDnCdoeVrwRaTy-.iiPCR and duplex Isne snusli atitveed diseot ethc teiromnaolf r celvaes rssicea tlrsawnsincre ipfet avseer PvCirRu s(.i iTRrTa -nPsCbRo)u fnodr. rE ampie dr gan.Ddis., PEDV /PDCoVrRT -PC Rassa ysdevelop edand evaluated int hecur- http://dx .doi.org/10 .1 111/tbed .12318 . Ma,Y.,Zhang,Y.,Liang,X.,Lou,F.,Oglesbee,M.,Krakowka,S.,Li,J.,2015.Origin, dreentet csttiuodnyo wfPeEreD oVvaenradl/lo croPmDpCaorVa.bTleh etoP tEhDeV reafnedrePnDceC orRVTR-PTC-iRiPsC fRosr MevBo ilout6io,en0, 0an0 6d4 v.irul enc e of po rcine delta cor onaviruses in the U nited States. are poten tia lly use ful too ls for on -sit e dete ction and t he duplex Madson,D .M .,Magstadt,D.R.,Arruda,P.H.,Hoang,H.,Sun,D.,Bower,L.P., Bhan dari,M .,Burrou gh,E. R.,Gaug er,P. C.,Pillat zki ,A.E. ,St evenson ,G.W., PEDV/PDCoV rRT-PCR provides a convenient method to simultane- Wilberts, B.L., Brodie,J., Harm on,K.M .,Wa ng,C.,M ain,R .G.,Zhang, J.,Yoon,K.J., ouslydetectthetwovirusesanddifferentiatePEDVfromPDCoV. 2014.Pat hoge nesisof p orcineep idemi cdiarr hea virus isola te (US/Io wa/18984/20 13 )in3-w eek-oldw eanedpig s.Ve t.Microbiol.174,60–68. Marthaler,D.,Raymond,L., Jia ng,Y.,Collin s,J.,Ros sow, K.,Ro vira,A.,20 14.R apid Acknowledgements detecti on, complete gen ome seq uencing ,a ndphylo ge netican aly sisof porcine deltacoron avirus.Em erg.Infe ct.Dis.20,1 347– 1350. Mesquita,J.R.,Hakze- vander Honin g,R., Alm eida,A.,Lourenco,M.,vanderPoel, ThisstudywassupportedbytheIowaStateUniversityCollegeof W.H., Nasc imento,M. S.,2 015.ATo ut breakofp or cineepide mic diar rhe avirus Veterin aryMe dici neStart-up fu nda ward edto Dr.Jianqia ngZhan g. inPor tugal,2015.T ransb ound .Em erg.Dis. 62 ,586–58 8. Wearegra tefultoth eIowaSt ateU niversity V eter inaryDiag nostic Opries snig,T.,X iao,C. T.,Gerber,P.F .,Zhang ,J., Halb ur,P.G.,2014.Porcineepidemic diarrhe av irusR NAp resenti ncom merci al spray-d ried porcin eplasm aisnot Laboratory faculty and staff for assistance with some testing. Paarilnbfeercgt,ioPu.L s. ,t2o0 n1 a4i.vUe p pdigast.e PdLeo sSt iO mnaet e9d, ee1c0o4n7o 6m6i.cwelfare impacts ofporc in e epidem icd iarrhe avirus(P EDV).http ://agecons earch.um n.edu/b its tream/ References 174517/2 /14-4. Updated%20Estimated%20Economic%20Welfare%20Impacts%20of%20PEDV. Alonso,C.,Goede,D.P.,Morrison,R.B.,Davies,P.R.,Rovira,A.,Marthaler,D.G., pdf. BCCCahharleeaannpuiiKsdecM2STBaisgnsnwunpc,,o–uiusr.o uMaflfahoQQitidr1rreilnerd,our dinpwa ..5c.rylLegp,,ef,eti oe,ht .f.a LGame eMmaenJ C tse vi,.ir, thda ,e ,zin.atoU haiaJ GnuYeG :azc. rihl,o vt. . , gnuaaeB5.,Pd Mhvegi, Kenn,el Sr.-Oiire Sel,rrRua. dga at,dJ ftLn ,uCrUr.gM,s l.oaas,e GPyy ersK Psy.rsnMaeh. h st..t kI.,VH-,,niir,C iaeT n octSsoa2eZePd3da.e a ,tl,d,Na0ht o. d N datHlY C.Jvdls1 ,af uf. - aR8.o ,ihne.SnDn4,t arc,n T e nittaeTeu g.slG.mead Uhs,en,o,uiE s, cat.w D iDoMnng eJevbeect4g.mes,ai, i.ip ast n 5,ptA.od Hyr 2.t,riaeY a,eosnaedciJpT 0s.d,7.cs,olFlin e h es1 yo dA,C hN3.op Socm ,o4Jmf b le..nei.t.Ac W,imT.,ga iayin ,iSednoIDo .alit K,s.kaaerri , elaft oon SMbaons it.eRsliJlhstl,ssyogn.g ld a.e,i.peumJ,oz ri c,f t.SnVc Wown,eleoriHc ata osAiocrrea,heritl n.c.netb IpTtra eovavi.iJ,hlr Rin.v pnd. elicai,Auo on riV.dnhr ent2,tldi.ag oh ., s,ys,ird0H d l ayra5NoeoeWM 1o,Roe acc at2 n4a24PllmhfhhN.c.,.,t,8m R0 .. aetaea ,2MGAZ2 mRi.1irrcsB,,3ohr ., maa3.oeaW BPub e4n5apcJ ttri.rlo.d– an1h,t lo ilr. rllVe,rd,l2iC g–eoona o snBrKRe 4,hs5ntdeuad ieuztuJ.Tz3a9agvsLge.. kr,a l-.pm s ..i hDtt2r,dpi2rte eos,o,iu20i bi0C coArasEout0s7e1tRcntog..u gi1,r,aEic5 o n nh(ts6fioM1ne..nib,., e,6 f li. tcP GI Trl R a ES–eonp eaae.cdTa.eMs7fpt voRaudu s- hl 2eerkif.epol.igd,roc,tqs. ac nCoHaeuietTgugtn.mm,Rrmries a nieo,2Dea)n nrooP ni3im.eaic,,sn.c, CsotYoigsi.tf.,cnayL ay,., PPSSSSiootaunasnnrdhiaggBTFedcraefWeWoclanue,,okaespppefeo ,a DDlts iruen,aliiimolA rrovtddd,-Jin..,t olna.s,, .Jleceeeaeo, Q,k.escs sZP i,jmmmmsBGl paeunaoo.haeZ,,e tn, aeormgrciiiiJoo HeroncccS.ukcbtnu,euhd h,e.nta,gadddA gl,l ,ia K ,aB ts aecvwP niiigXlneH,raaa.vhe.re o,ee, deS.i rrr, ixe.e ,T otr2n,r rrre,. P hpaPr ,nfhulhhhT0o vY.e-pnFei ,,asaeee1madL d .euenZdA, nnaaala 2iiderOxuhgeane. ang.mm, ivv, ,rar aaj nw ,P gUsUiiksrR QtnsrrY,ie o,hei iCroo .SuuPg.oqcCa,.rna,o ,lna ss,.,cnH uso.Ci , ,e2s,n ,gJ r Diw igeLSo.ahnaR0Toonan,.eny .n ueeih,1fniYd, iu n rt, scnkn Mr2 5dagaoztewodeece ,wi0..,imops ue .laia,YeN TaK1aaw niV xatgDacodn.rng4.he,,ti,neiha n f.e anecd.nKZwe,K t no ,nmlth,Io. .hPre. yni h RsslJG,nEaMst oya. stbivie.,Miirm c.i, nnih ks,Go e Hcaeis 2fi, cgolEd.s .us meCem,a s0arr, otmaTinr rLahorsain0Fenrgrmagmatmdibrb.ad9ar.-n,n,adr . igkunad. IoPHhptoan viEneunCirnsen.:lola,omu,fydbe. lyht i, eeAicC,nage -1s o d.iKeccpaP H.hn cn ,7Bu,ef iitr .o. tAnogonve,,.yB9gMnn e r2,sioKrD.tea.,lt dd,cr o eoT C0jsiDt2eeui2i. afi -tm..sn o1 s9mt ,sE0i,Vli. Vc hsdeui5, Z:6Cm1 e1kae. ei Peat. h–ad.,r5 te56tbr, e.Pe iu a2.Sr,e.g ,c1So r n sCr oRnK.s9El1eoew,,gnttgR lge8menramG13Wae.,s e-as, dk.cc1D9 paeb.oeikTpeoske 27nknri1arfl. r irsoe,o–a –o goess1 epoo.Lvv, fe1n4essfh, 6nof i iaKe dnp11w ,p1d4e2tpa ln.Ac1o0e4eon,,4,vou b er5.nnR.Hr25s,i,rt c ocr .itc1.o.7c,Haiv,u iiceniS6fn5aneknsu .e7lp–ead, ,elar –nyo5eHen1rd8lvg.,c,7 0i,Kie 5n.D.w.,e., 42 J.Zhangetal./JournalofVirologicalMethods234(2016)34–42 Stevenson,G.W.,Hoang,H.,Schwartz,K.J.,Burrough,E.R.,Sun,D.,Madson,D., Wang,L.,Byrum,B.,Zhang,Y.,2014a.2014.Detectionandgeneticcharacterization Cooper ,V.L., Pillatzki ,A. ,Gauger,P .,Sc hmitt,B.J., Kost er,L. G., Killian,M .L., of del tacoron avi rusinp igs ,Ohio, USA.E merg.Infe ct.D is.20,1 227–1230. Yoon,K. J.,20 13.Emer gen ceofPo rci neepidem ic diarrhea viru sinthe United Wang ,L.,Byrum,B.,Zha ng ,Y.,2 014b. New variant ofpor cine epi demicdiarrhea States :clin icals igns,lesions ,a ndviral genomics equence s.J.Ve t. Diag n.Invest. vir us, United Sta tes,201 4. Emerg. Infec t.Dis.2 0, 917–919 . 25,649 –654. Wang,L., Zhang, Y.,Byru m,B., 2014c. Develo pme nta ndevaluationofaduplex Sun,R.Q .,Cai,R.J.,Chen,Y.Q.,Liang,P.S.,Chen,D.K.,Song,C.X.,2012.Outbreakof rea l-t imeRT -PC Rforde tec tionan ddifferentiati ono fvirulenta nd v ariant p orcin eep ide micdi arrhe ainsu cklin gpigl ets,C hina. Emer g.Infe ct.Dis.18 , strainsof porcine epi demicdia rrhe avirusesfromt he UnitedS tate s.J.Virol. 161–163 . Method s 207,154 –157. Theuns,S.,Conceicao-Neto,N.,Christiaens,I.,Zeller,M.,Desmarets,L.M., Wilkes,R.P.,T sai, Y.L.,Lee,P.Y.,Lee,F.C.,Chang,H.F.,Wang,H.T.,2014a.Rapidand Rou kae rts,I.D.,Acar,D.D .,H eylen,E.,M at thijnsse ns, J.,Nauwync k,H.J.,2015. sens itive dete ction ofc anin edis tem perviru sby one-tu bere verse Completeg eno mese quen ceofap orc ineepidemicd iar rheavirusf rom anovel transcrip tion-insula te disoth ermalpoly meras ec hainreac tion.BMCVet.Res. outbreaki nbelgiu m,january 2 01 5.Geno meAnnou nc.3. 10,213. Thomas,J.T.,C h en,Q.,Ga uger,P.C .,Gim enez-Liro la,L.G.,Si nha,A.,Harmon,K.M., Wilkes, R.P.,Tsai,Y.L.,Lee,P.Y.,Lee,F.C.,Chang,H.F.,Wang,H.T.,2014b.Rapidand Mads on, D.M., Bur rough,E .R.,M agstadt,D.R.,Sa lzbre nner,H .M .,Welch, M.W., sens itive dete ction ofc anin edis tem perviru sby one-tu bere verse Yoon,K.J .,Zim merman,J. J.,Zh ang,J.,201 5.Ef fectofporcin eepid emicdi arrhea transcrip tion-insula te disoth ermalpoly meras ec hainreac tion.BMCVet.Res. virusi nfec tiousdoseso nin fection ou tcom esinn aiv econve ntionalne onatal 10,213. andw eanedpig s.PLoS O ne10,e01 39266. Wilkes, R.P.,Kania,S.A.,Tsai,Y.L.,Lee,P.Y.,Chang,H.H.,Ma,L.J.,Chang,H.F.,Wang, Tsai,Y.L .,Lin,Y.C .,Cho u,P.H .,Te ng, P.H.,Lee,P.Y.,2012a.Detectionofwhitespot H.T. ,201 5a.Rap ida ndse nsiti vede tect ionofF eline imm uno deficie ncyv irus s yndr ome viru sbyp olym erase chain rea ction perfor medunder in sulate d using anins ulated isot hermalPC R-baseda ss aywith apoint-of-needPC R isotherma lcond itio ns.J.Virol.M etho ds181,1 34–137. detec tion platform .J.Vet.Diag n.Invest.2 7,510 –515 . Tsai,Y.L.,Wang ,H.T.,Chang , H.F.,T sai,C.F.,L in,C. K.,Teng,P.H.,Su,C.,Jeng,C.C.,Lee, Wilkes,R.P.,L ee,P.Y.,Ts a i,Y.L .,Tsai,C .F.,Cha ng, H.H.,Chang,H.F.,Wang,H.T., P .Y.,2 012b. Deve lopmen tofT aqM anp robe -bas edins ulate dis oth erma lPCR 201 5b.A nin sulat ediso ther mal PCR method ona field-de ploy ablede vicefor (iiPC R)fors ensitiveandsp ec ificon-s itepathogen detection. PLoSOne7 , rapida nds ensitived etectionof cani neparvo vir u stype2atpoints ofneed .J. e45278 . Virol. Met hods220 ,35–38. Tsai,Y.L.,Wang,H.C.,Lo,C.F.,Tang-Nelson,K.,Lightner,D.,Ou,B.R.,Hour,A.L.,Tsai, Woo,P.C. ,Huang,Y .,Lau ,S.K.,Yuen,K.Y.,2010.Coronavirusgenomicsand C .F.,Y en,C.C .,Cha ng, H.F. ,Teng,P.H.,Le e,P .Y.,2014. Va lida tiono faco mme rcial bi oinfo rmatic san alys is.Vi ruses 2,18 04–18 20. insu lated isot hermal PCR- based POC KITt estfo rrapi dandeasy de te ctionof Woo,P.C.,Lau,S.K. ,Lam,C.S .,Lau,C. C., Tsang,A.K.,Lau,J.H.,Bai,R.,Teng,J.L.,Tsang, whitespo tsyndrome virusinfec tioninL itop ena eusva nnam ei.P LoSOne9 , C. C.,W ang ,M., Zheng ,B.J .,Cha n,K. H.,Yue n,K.Y .,20 12.D isco ve ryofs eve n e9054 5. nove lMam mal ianand avia ncoro navi ruses inthe genu sdeltacoro na virus Vlasova,A.N.,Marthaler,D.,Wang,Q.,Culhane,M.R.,Rossow,K.D.,Rovira,A., suppo rtsbatcoron avir usesa sthegenesou rce ofa lphaco ronavirusand Colli ns,J., Saif,L.J.,20 14 .Distin ctc haracteri sticsa ndcomp lexe volutio nof betacoron avi rusandavianc or ona viruse sasth eg enesourceof PEDVst ra ins,n orth ame rica,May 2013–Februar y20 14.Emer g.Infect.D is.20, gammacoronavir usa ndde ltacoronavirus .J. Viro l.86, 3995–4 008. 1620– 1628. Vui,D.T.,Thanh,T.L.,Tung,N.,Srijangwad,A.,Tripipat,T.,Chuanasa,T.,Nilubol,D., 2015 .Compl eteg enom ec haracterizati on ofporcin ee pidemicdi arr heaviru sin Vietna m.Arch.V irol160 ,1931–1938.