JVI Accepts, published online ahead of print on 22 June 2011 J. Virol. doi:10.1128/JVI.00447-11 Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 3 4 5 Cleavage of the Adaptor Protein TRIF by Enterovirus 71 3C Inhibits Antiviral Responses 6 Mediated by Toll-like Receptor 3 7 Xiaobo Lei1‡, Zhenmin Sun1‡, Xinlei Liu1, Qi Jin1†, Bin He2†*, Jianwei Wang1†* D o 8 1State Key Laboratory of Molecular Virology and Genetic Engineering, Institute of Pathogen w 9 Biology, Chinese Academy of Medical sciences & Peking Union Medical College, Beijing n 10 100730, P.R. China; 2Department of Microbiology and Immunology, College of Medicine, loa 11 University of Illinois, Chicago, IL 60612, USA d e 12 d 13 fr o 14 Running title: m 15 h 16 TRIF Cleavage by the 3C protease tt p 17 :/ / 18 jv 19 ‡These authors contributed equally to this work. i.a s 20 m 21 *Address all correspondence to: . o 22 rg 23 Dr. Jianwei Wang / o n 24 Tel./Fax: +86-10-67828516; E-mail: [email protected] A p 25 Dr. Bin He r il 1 26 Tel.: 312-996-2391; Fax: 312-996-6415; E-mail: [email protected] 0 , 27 2 0 1 28 † Q.J., B.H., and J.W. contributed equally to this work and are co-senior authors of the paper. 9 b 29 y g 30 Word count: abstract, 211 worlds; the text, 3,732 words u e s 31 t 32 33 1 34 ABSTRACT 35 Enterovirus 71 (EV71) causes hand-foot-and-mouth disease and neurological 36 complications in young children. Although the underlying mechanisms remain obscure, 37 impaired or aberrant immunity is thought to play a role. In infected cells, EV71 suppresses type 38 I interferon responses mediated by retinoid acid inducible gene-I (RIG-I). This involves the D 39 EV71 3C protein that disrupts the formation of a functional RIG-I complex. In the present study, o w n 40 we report that EV71 inhibits the induction of innate immunity by Toll-like receptor 3 (TLR3) via lo a d 41 a distinct mechanism. In HeLa cells stimulated with poly (I:C), EV71 inactivates interferon e d f 42 regulatory factor 3 and drastically suppresses interferon-stimulated gene expression. Notably, ro m 43 EV71 specifically down-regulates an adaptor TIR domain-containing adaptor inducing IFN-β h t t p : 44 (TRIF). When expressed alone in mammalian cells, EV71 3C is capable of exhibiting these // jv i. 45 activities. EV71 3C associates with and induces TRIF cleavage in the presence of Z-VAD-FMK, a s m 46 a caspase inhibitor. TRIF cleavage depends on its amino acid pairs Q312S313, which resemble a .o r g / 47 proteolytic site of picornavirus 3C proteases. Further, site-specific 3C mutants with a defective o n A 48 protease activity bind TRIF but fail to mediate TRIF cleavage. Consequently, these 3C mutants p r il 49 are unable to inhibit NF-κB and interferon-β promoter activation. TRIF cleavage mediated by 1 0 , 2 50 EV71 may be a mechanism to impair type I IFN production in response to TLR3 activation. 0 1 9 51 b y g 52 u e s 53 t 54 55 2 56 INTRODUCTION 57 Enterovirus 71 (EV71), a member of the Picornaviridae family, is a causative agent of 58 hand-foot-and mouth disease (HFMD) in young children and infants. Severe infection with 59 EV71 may lead to various neurological complications, including aseptic meningitis, acute flaccid 60 paralysis, encephalitis and neurogenic pulmonary edema (29). EV71 outbreaks occur D 61 periodically through the world, especially in the Asia-Pacific region (1, 2, 9, 12, 19, 24, 28, 29, o w n 62 51). The EV71 genome is a positive-stranded RNA molecule that encodes a single polyprotein lo a d e 63 precursor about 2,200 amino acids. This precursor is processed into structural (VP1, VP2, VP3, d f r o 64 and VP4) and non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C, and 3D) upon infection (29). In m h 65 this process the viral proteases, 3C and 2A, work coordinately to facilitate viral replication. t t p : / 66 The 3C protein encoded by EV71 is essential for viral replication (45, 46). In addition to /jv i. a 67 its activity in viral protein processing (25), 3C participates in several other processes. The 3C s m . o 68 protein binds to the 5’ untranslated region of viral RNA but its effect on viral infection is r g / o 69 unknown (45). When expressed in neuronal cells 3C induces apoptosis through caspase n A 70 activation (25). This is thought to facilitate viral spread or pathogenesis. Furthermore, 3C p r il 1 71 cleaves cellular CstF-64 protein (49). This impairs the 3’ end of host RNA processing and 0 , 2 72 polyadenylation, thus providing an additional advantage for viral replication. Of note, 3C blocks 0 1 9 73 type I interferon (IFN) responses that exert antiviral and immunoregulatory activities (22). b y g 74 Type I IFN is induced via Toll-like receptor (TLR) related pathways (17). It is well u e s t 75 established that TLR3 in the endosome recognizes viral double-stranded RNA (dsRNA). Once 76 activated, TLR3 recruits an adaptor TIR domain-containing adapter inducing IFN-β (TRIF) (17), 77 which together with TNF receptor-associated factor 3 (TRAF3), activates the two IKK related 78 kinases, TANK-binding kinase 1 (TBK1) and inducible Iκ-B kinase (IKKi). These kinases 3 79 phosphorylate interferon regulatory factor 3/7 (IRF-3/7) (8, 11, 34, 44), leading to the expression 80 of target genes, such as IFN-α/β (30, 35, 39, 50). Additionally, TRIF stimulates NF-κB 81 activation via the receptor interacting protein 1(RIP1) and TRAF6, resulting in the production of 82 pro-inflammatory cytokines, such as Interleukin-6 (14, 15). TRIF is a 712 amino acid protein 83 present in the cytoplasm. While its amino-terminus interacts with TRAF6 and TRAF3 the D o 84 carboxyl terminus binds to TLR3 and RIP1 (11, 14, 31, 34). Accordingly, TRIF serves as a key w n 85 adaptor that transmits signals to IRF3 and NF-κB, respectively. Alternative receptors exist to lo a d e 86 detect cytosolic viral RNA (17). Examples are retinoid acid inducible gene-I (RIG-I) and d f r o 87 melanoma differentiation-associated gene-5 (MDA5), which induce cytokine expression via an m h 88 adaptor IPS-1 (17, 18, 53). tt p : / / 89 It has been reported that picornaviruses are primarily sensed by MDA-5 (10, 16), but jv i. a 90 recent evidence suggests a role for RIG-I as well (37). In infected cells, several picornaviruses s m . o 91 cleave or interact with these pattern recognition receptors (3, 4, 22, 37). TLR3 also recognizes or r g / o 92 limits picornavirus infection (33, 41, 48). Unfortunately, little is known on how picornaviruses n A p 93 are involved. Here, we report that EV71 suppresses TLR3-mediated type I IFN responses by r il 1 94 down-regulation of TRIF. This requires EV71 3C which interacts with TRIF and induces its 0 , 2 0 95 cleavage independently of caspases. TRIF cleavage depends on its amino acid pairs Q312 and 1 9 b 96 S313. H40, KFRDI and VGK motifs in 3C are not required to bind TRIF. But they are y g u 97 indispensible to inactivate NF-κB and IFN-β promoter via TRIF cleavage. These results suggest e s t 98 that control of TLR3 by EV71 3C may be a mechanism to disrupt type I IFN responses. 99 MATERIALS AND METHODS 100 Cell lines and viruses. RD (rhabdomyosarcoma), 293T and HeLa cells were cultured in 101 Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) supplemented with 10% 4 102 heated-inactivated fetal bovine serum (FBS) (HyClone, Logan, UT), and penicillin/streptomycin 103 at 37°C in a 5% CO humidified atmosphere. 293/TLR3 cells were a gift of Dr. Zhengfan Jiang. 2 104 Enterovirus 71 (EV71) infection was carried out as follows. Briefly, cells were infected with 105 EV71 at indicated multiplicity of infection (MOI). Unbound virus was washed away 2 h after 106 infection and cells were cultured with fresh medium supplemented with 10% FBS. D o 107 Plasmids and reagents. The plasmids pEGFP-3C, pCDNA3.1-Flag-3C, and pEGFP-3C w n lo 108 variants have been described elsewhere (22). The Flag-TRIF variants, including ∆311-336, a d e 109 ∆337-367, ∆368-398, ∆399-438, ∆439-485, ∆311-485 and amino acid substitution mutants, were d f r o 110 constructed by site-directed mutagenesis using Pfu DNA polymerase (Stratagene, La Jolla, CA). m h t 111 All variants were confirmed by subsequent sequencing. Antibodies against Flag, Myc, GFP, tp : / / 112 IRF3 and β-actin were purchased from Sigma (St.Louis, MO). Anti-TRIF, anti-MyD88, anti- jv i. a s 113 TBK1 and anti-RIG-I antibodies were purchased from Cell Signaling technology (Danvers, MA). m . o 114 Antibody against phosphorylated IRF3 (pS386) was purchased from Epitomics (Burlingame, CA) rg / o 115 Goat-anti mouse or rabbit secondary antibodies were purchased from Li-COR Company (LI- n A p 116 COR Inc., Lincoln, NE). The caspase inhibitor Z-VAD-FMK and poly (I:C) were purchased r il 1 0 117 from Sigma (St. Louis, MO). , 2 0 118 Reporter assays. Reporter assays were performed as described (7). Briefly, 293T or 1 9 b 119 293/TLR3 cells were seeded in 24-well plates at a cell density of 3×105 cells per well. Next day y g u 120 cells were transfected with a control plasmid or plasmid expressing TRIF, MyD88 and 3C e s t 121 variants along with pGL3-IFN β-luc, NF-κB-luc and pRL-SV40 using Lipofectamine 2000 122 (Invitrogen, Carlsbad, CA). The total amount of DNA was kept constant by adding empty 123 control plasmid. At 24 h after transfection cells were harvested and cell lysates were used to 124 determine luciferase activities (Promega, Madison, USA). 5 125 Reverse transcription PCR. Total RNA was extracted from cells by using TRIzol 126 reagent (Invitrogen, Carlsbad, CA). RNA samples were treated with DNase I (Pierce, Rockfold, 127 IL) and reverse transcription was carried out using the Superscript cDNA synthesis kit 128 (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. cDNA samples were 129 subjected to PCR amplification and electrophoresis to detect ISG54, ISG56, and IL-6 D 130 expression. Primers used were as follows: human ISG54, CTGCAACCATGAGTGAGAA and o w n 131 CCTTTGAGGTGCTTTAGATAG; human ISG56, TACAGCAACCATGAGTACAA and lo a d e 132 TCAGGTGTTTCACATAGGC; IL-6, GCCCTGAGAAAGGAGACAT and d f r o 133 CTGTTCTGGAGGTACTCTAGGTAT; GAPDH, CGGAGTCAACGGATTTGGTCGTA and m h 134 AGCCTTCTCCATGGTGGTGAAGAC. t t p : / 135 Immunoprecipitation. Cells were lysed with RIPA [25 mM Tris-HCl buffer (pH7.4) /jv i. a 136 containing 150 mM NaCl, 1%NP-40, 0.25% sodium deoxycholate], containing protease inhibitor s m . o 137 cocktail (Roche, Indianapolis, IN). Lyates of cells were incubated with anti-flag antibody r g / 138 (Sigma, St.Louis, MO) in 500µl RIPA buffer at 4oC overnight on a rotator in the presence of on A 139 protein A/G agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA). Immunocomplexes p r il 1 140 captured on the affinity gel or protein A/G agarose beads were subjected to electrophoresis and 0 , 2 141 immunoblotting analysis (47). 0 1 9 142 Western blot analysis. Cells were pelleted by centrifugation and lysed in buffer b y g 143 containing 150 mM NaCl, 25 mM Tris pH 7.4, 1%NP-40, 0.25% sodium deoxycholate, 1 mM u e s t 144 EDTA with protease inhibitor cocktail (Roche, Indianapolis, IN). Aliquots of cell lysates were 145 resolved on 12% SDS-PAGE and transferred to a nitrocellulose membrane (Pall, Port 146 Washington, NY). The membranes were blocked with 5% non-fat dry milk and then probed 147 with indicated primary antibodies at 4°C overnight. This was followed by incubation with 6 148 corresponding IRD Fluor 800-labeled IgG or IRD Fluor 680-labeled IgG secondary antibody 149 (LI-COR Inc., Lincoln, NE). After washing, the membranes were scanned with the Odyssey 150 Infrared Imaging System (LI-COR, Lincoln, NE) at a wavelength of 700-800 nm and The 151 molecular sizes of the developed proteins were determined by comparison with prestained 152 protein markers (Ferments, Maryland, CA). D 153 RESULTS o w n 154 EV71 suppresses the induction of innate antiviral immunity by poly (I:C) in infected lo a d e 155 cells. To study the effect of EV71 on the TLR3 pathway, we measured the induction of antiviral d f r o 156 immunity by poly (I:C), a prototype of TLR3 agonist. HeLa cells were initially mock infected m h 157 or infected with EV71 for 4 h. At various time points after incubation with poly (I:C), the cells t t p : / 158 were examined for the expression of ISG54, ISG56, interleukin-6, and GAPDH by RT-PCR /jv i. a 159 analysis. As shown in Figure 1A, poly (I:C) induced ISG54 and ISG56 expression in mock s m . o 160 infected cells, which peaked around 4 h after the treatment (lanes 1, 3, 5, 7, and 9). Such r g / o 161 induction by poly (I:C) was sharply reduced in cells infected with EV71 at all time points n A 162 examined (lanes 2, 4, 6, 8, and 10). Under these conditions, most cells were viable (96%) as p r il 1 163 measured by the trypan blue exclusion assay (data not shown). Interestingly, EV71 inhibited 0 , 2 164 IRF3 phosphorylation by poly (I:C) as compared to mock infected cells (Fig. 1B, lanes 1-4). 0 1 9 165 Poly (I:C) stimulated interleukin-6 expression in mock infected cells, with an early kinetics (Fig. b y g 166 1A, lanes 1, 3, 5 and 7). Intriguingly, EV71 infection enhanced this effect (Fig. 1A, lanes 4, 6, 8, u e s t 167 and 10), suggesting that EV71 replication stimulated interleukin-6 expression. As expected, 168 GAPDH expression remained at comparable levels in cells treated or untreated with poly (I:C) 169 (Fig. 1A, lanes 1-10). Herein, EV71 infection differentially modulates the expression of ISG54, 170 ISG56 and interleukin-6. 7 171 The 3C protein of EV71 impairs the induction of antiviral molecules by poly (I:C). 172 Among proteins encoded by EV71, 3C inhibits virus-induced immunity by interacting with RIG- 173 I (22). Since EV71 blocked poly(I:C)-mediated responses, we hypothesized that 3C might 174 contribute to this process. To test this possibility, HeLa cells were transfected with GFP or GFP- 175 3C plasmid, with approximately 60% of ransfection efficiency. At 24 h after transfection, cells D 176 were incubated with poly (I:C) and the expression of ISG54, ISG56, IL-6, and GAPDH was o w n 177 analyzed by RT-PCR assays. As indicated in Figure 2A, GFP-3C reduced the expression of lo a d e 178 ISG54, ISG56 and IL-6 whereas GFP displayed no inhibitory effect (lanes 1-10). In correlation, d f r o 179 GFP-3C inhibited poly (I:C)-induced IRF3 phosphorylation as compared to GFP (Fig.2B, lanes m h 180 1-4). When expressed in 293/TLR3 cells, the 3C protein also inhibited ISG56 and IFN-β t t p : / 181 promoter activation induced by poly (I:C) as compared to GFP (Fig.2C and D). These results /jv i. a 182 suggest that EV71 3C is able to inhibit dsRNA-induced innate immunity. s m . o 183 The 3C protein inhibits IFN-β and NF-κB activation by down-regulation of TRIF. r g / o 184 When engaged with TLR3, TRIF activates IRF3 and NF-κB, leading to type I IFN production n A 185 (17). Therefore, we assessed the impact of 3C on TRIF in reporter assays. As illustrated in p r il 1 186 Figure 3A, TRIF stimulated IFN-β promoter activation in 293T cells. Addition of 3C inhibited it 0 , 2 187 in a dose dependent manner. Likewise, 3C suppressed NF-κB activation by TRIF (Fig. 3B). 0 1 9 188 Under this experimental condition, EV71 3C did not inhibit MyD88 stimulated NF-κB activation b y g 189 (Fig. 3C). It appears that the 3C protein inhibited the TRIF but not MyD88 function, suggesting u e s t 190 TRIF as a potential cellular target. To evaluate this, we determined whether EV71 3C affected 191 the TRIF expression. As shown in Figure 3D, EV71 3C reduced the level of endogenous TRIF 192 in a dose dependent manner when expressed in HeLa cells. This reduction was not detectable 193 with TBK1. Thus, EV71 3C reduces TRIF expression and inhibits its activity. 8 194 Next, we analyzed TRIF expression in EV71 infected cells. Cells were mock infected or 195 infected with EV71. At different time points post-infection, cells were processed and examined 196 by Western blot analysis. Figure 4A shows that HeLa cells constitutively expressed TRIF, 197 MyD88, TBK1, IRF3 and β-actin (lane 1). EV71 infection had different effects on these proteins 198 (lanes 2-5). Strikingly, the level of TRIF decreased as EV71 infection progressed. This D o 199 coincided with an increase in 3C expression. In contrast, MyD88, IRF3, TBK1, and β-actin w n lo 200 exhibited no or little reduction in EV71 infected cells. This was reproducible in several a d e 201 experiments. At 12 h after infection, EV71 reduced TRIF by approximately 70% (Fig. 4B). A d f r o 202 similar pattern was also observed in RD cells (Fig. 4C, lanes 1-5). These results indicate that m h 203 EV71 specifically down-regulates TRIF in mammalian cells. tt p : / / 204 EV71 3C associates with and induces TRIF cleavage independently of caspases. To jv i. a s 205 examine the nature of 3C-TRIF interactions, we carried out immunoprecipitation analysis in m . o 206 293T cells expressing Flag-TRIF, GFP and GFP-3C. As illustrated in Figure 5A, GFP-3C but rg / o 207 not GFP co-precipitated with Flag-TRIF, indicating an interaction between 3C and TRIF. n A p 208 Notably, 3C reduced the TRIF level in the immunprecipitates as compared to GFP (lanes 3 and r il 1 209 4). This was accompanied by the appearance of a small species (45-kDa) (lane 4). Western blot 0 , 2 0 210 analysis revealed comparable levels of GFP, GFP-3C and β-actin in cell lysates (lanes 1-4). 1 9 b 211 However, GFP-3C decreased TRIF expression (lane 4). In correlation, a small band appeared y g u 212 (lane 4). This is presumably a TRIF cleavage product. To further address this issue, we carried e s t 213 out a dose response analysis in 293T cells co-transfected with 3C and TRIF. As shown in Figure 214 5B. TRIF expression decreased as the level of GFP-3C increased. As expected, a smaller species 215 appeared (lanes 2-6). Similar results were obtained with Flag-3C (data not shown). Hence, 216 EV71 3C has a capacity to induce TRIF cleavage. 9 217 Previous studies showed that the 3C protein of EV71 activates caspases (25). To test 218 whether 3C functioned via caspases, we assessed TRIF cleavage in the presence or absence of Z- 219 VAD-FMK, a pan-caspases inhibitor. Figure 5C shows that GFP-3C induced the cleavage of 220 TRIF, resulting in a 45 kD protein band (lane 2). Treatment with Z-VAD-FMK did not inhibit 221 this cleavage (lane 3). The enhanced TRIF cleavage by Z-VAD-FMK is attributable to a block D 222 of apoptosis. To corroborate this result, we further analyzed a TRIF mutant, D281ED289E o w n 223 substitutions, which is resistant to caspase cleavage (40). Similar to wild type TRIF, lo a d e 224 D281ED289E remained susceptible to 3C mediated cleavage (Fig. 5D). These results indicated d f r o 225 that 3C-mediated TRIF cleavage does not require caspases. m h 226 Glutamine 312 and serine 313 pairs within TRIF are required for 3C induced cleavage. t t p : / 227 As TRIF cleavage produced a 45 kD product, we inferred that the cleavage site(s) might fall in /jv i. a 228 the central region. To test this, we analyzed a series of TRIF mutants, which had deletions from s m . o 229 amino acids 311 to 485 (Fig 6A). These mutants were expressed along with a control GFP or r g / o 230 GFP-3C in 293T cells. Cell lysates were subjected to Western blot analysis. As illustrated in n A 231 Figure 6B, wild type TRIF was cleaved when ectopically expressed with GFP-3C, resulting in a p r il 1 232 45kD species (lane 2). Similarly, the TRIF deletion mutants ∆337-367, ∆368-398, ∆399-438, 0 , 2 0 233 and ∆439-485 were cleaved in the presence of GFP-3C (lanes 6, 8, 10, and 12). In contrast, 1 9 b 234 ∆311-336 and ∆311-485 were resistant to the 3C cleavage (lanes 4 and 14). Thus, the TRIF y g u 235 cleavage site may sit between amino acids 311 to 336 (Fig. 6C). This region contains three e s t 236 amino acid pairs, represented by Q312S313, Q331T332, and Q335L336, which resemble a 237 signature Q-G sequence of other picornavirus 3C proteolytic sites. 238 To define the putative TRIF cleavage site, we analyzed additional TRIF mutants. As 239 shown in Figure 6D, like wild type TRIF, ∆322-336 was susceptible to 3C induced cleavage